EMAIL THIS PAGE TO A FRIEND

DIS3L

DIS3 mitotic control homolog (S. cerevisiae)-like

63 Gene Product Result for
Synonyms: DIS3L1
UniProtKB ID: Q8TF46, Q8N1N8, Q8WTU9, Q96CM7
Gene ID:
Mouse(213550) DIS3 mitotic control homolog (S. cerevisiae)-like
Rat(363077) DIS3 mitotic control homolog (S. cerevisiae)-like
Zebrafish(560362) DIS3 mitotic control homolog (S. cerevisiae)-like
chicken(100857630) DIS3 mitotic control homolog (S. cerevisiae)-like
domestic cat(101081898) DIS3 mitotic control homolog (S. cerevisiae)-like
cow(777771) DIS3 mitotic control homolog (S. cerevisiae)-like
Horse(100066072) DIS3 mitotic control homolog (S. cerevisiae)-like
dog(478346) DIS3 mitotic control homolog (S. cerevisiae)-like
naked mole-rat(101717347) DIS3 mitotic control homolog (S. cerevisiae)-like
domestic guinea pig(100713162) DIS3 mitotic control homolog (S. cerevisiae)-like
sheep(101111971) DIS3 mitotic control homolog (S. cerevisiae)-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133375 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133375 Rosetta Predictions human pricing
NM_001008380 Rosetta Predictions rat pricing
NM_001001295 Rosetta Predictions mouse pricing
NM_172519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161435 predicted 608
2 SASI_Hs01_00161436 predicted 1697
3 SASI_Hs01_00161439 predicted 934
4 SASI_Hs01_00161440 predicted 919
5 SASI_Hs01_00161442 predicted 626
6 SASI_Hs01_00161443 predicted 1660
7 SASI_Hs02_00363083 predicted 2320
8 SASI_Hs01_00161444 predicted 1478
9 SASI_Hs02_00363084 predicted 2524
10 SASI_Hs02_00363085 predicted 1463
11 SASI_Hs01_00161437 predicted 1111
12 SASI_Hs01_00161438 predicted 1110
13 SASI_Hs01_00161441 predicted 2889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070500 predicted 2409
2 SASI_Rn02_00199155 predicted 2822
3 SASI_Rn01_00070501 predicted 1702
4 SASI_Rn01_00070502 predicted 1203
5 SASI_Rn02_00199156 predicted 2349
6 SASI_Rn02_00199157 predicted 1685
7 SASI_Rn01_00070506 predicted 709
8 SASI_Rn01_00070507 predicted 1229
9 SASI_Rn01_00070508 predicted 2384
10 SASI_Rn01_00070509 predicted 722
11 SASI_Rn01_00070503 predicted 2419
12 SASI_Rn01_00070504 predicted 2860
13 SASI_Rn01_00070505 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286112 predicted 1074
2 SASI_Mm01_00177764 predicted 1167
3 SASI_Mm01_00177765 predicted 1941
4 SASI_Mm01_00177767 predicted 1325
5 SASI_Mm01_00177768 predicted 1924
6 SASI_Mm01_00177769 predicted 2559
7 SASI_Mm01_00177770 predicted 1732
8 SASI_Mm01_00177771 predicted 2440
9 SASI_Mm01_00177772 predicted 763
10 SASI_Mm01_00177773 predicted 1865
11 SASI_Mm01_00177766 predicted 1765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344118 predicted 1039
2 SASI_Mm01_00185199 predicted 1129
3 SASI_Mm01_00185200 predicted 1906
4 SASI_Mm01_00185202 predicted 1302
5 SASI_Mm01_00185203 predicted 1893
6 SASI_Mm01_00185204 predicted 2528
7 SASI_Mm01_00185205 predicted 1710
8 SASI_Mm01_00185206 predicted 2403
9 SASI_Mm01_00185207 predicted 736
10 SASI_Mm01_00185208 predicted 1841
11 SASI_Mm01_00185201 predicted 1739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133375
VALIDATED
DIS3L MISSION shRNA Bacterial Glycerol Stock
DIS3 mitotic control homolog (S. cerevisiae)-like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_133375.3-1502s21c1
Sequence:CCGGGAACAAGGGCCACCACTTATTCTCGAGAATAAGTGGTGGCCCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133375.3-1660s21c1
Sequence:CCGGTGGTATGGCAGAACCATTATTCTCGAGAATAATGGTTCTGCCATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_133375.3-368s21c1
Sequence:CCGGACGCAGCTGTTTGGTACTATCCTCGAGGATAGTACCAAACAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_133375.3-3200s21c1
Sequence:CCGGCTGGGTAGCTATTTCGCATATCTCGAGATATGCGAAATAGCTACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_133375.3-2555s21c1
Sequence:CCGGGCATATCTGACGGAGTTATTTCTCGAGAAATAACTCCGTCAGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133375.2-934s1c1
Sequence:CCGGCGGGATTATGTGGTGACATTTCTCGAGAAATGTCACCACATAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133375.2-504s1c1
Sequence:CCGGCCACGAGCTTTGTGATTCTATCTCGAGATAGAATCACAAAGCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150758    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133375.2-3092s1c1
Sequence:CCGGGAGCTGTCATATGTGAATGTTCTCGAGAACATTCACATATGACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133375.2-2285s1c1
Sequence:CCGGCCCACTTTACTTCTCCAATAACTCGAGTTATTGGAGAAGTAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133375.2-237s1c1
Sequence:CCGGGCGTCATGATTGCATTCTCTTCTCGAGAAGAGAATGCAATCATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133375.2-332s1c1
Sequence:CCGGGCATATACAACGCAGCTGTTTCTCGAGAAACAGCTGCGTTGTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133375.2-2248s1c1
Sequence:CCGGGAGTTCCATCATTACGGTCTTCTCGAGAAGACCGTAATGATGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133375.2-3173s1c1
Sequence:CCGGCTGGGTAGCTATTTCGCATATCTCGAGATATGCGAAATAGCTACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133375
VALIDATED
DIS3L MISSION shRNA shRNA Plasmid DNA
DIS3 mitotic control homolog (S. cerevisiae)-like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_133375.3-1502s21c1
Sequence:CCGGGAACAAGGGCCACCACTTATTCTCGAGAATAAGTGGTGGCCCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133375.3-1660s21c1
Sequence:CCGGTGGTATGGCAGAACCATTATTCTCGAGAATAATGGTTCTGCCATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_133375.3-368s21c1
Sequence:CCGGACGCAGCTGTTTGGTACTATCCTCGAGGATAGTACCAAACAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_133375.3-3200s21c1
Sequence:CCGGCTGGGTAGCTATTTCGCATATCTCGAGATATGCGAAATAGCTACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_133375.3-2555s21c1
Sequence:CCGGGCATATCTGACGGAGTTATTTCTCGAGAAATAACTCCGTCAGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133375.2-934s1c1
Sequence:CCGGCGGGATTATGTGGTGACATTTCTCGAGAAATGTCACCACATAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133375.2-504s1c1
Sequence:CCGGCCACGAGCTTTGTGATTCTATCTCGAGATAGAATCACAAAGCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150758    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133375.2-3092s1c1
Sequence:CCGGGAGCTGTCATATGTGAATGTTCTCGAGAACATTCACATATGACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133375.2-2285s1c1
Sequence:CCGGCCCACTTTACTTCTCCAATAACTCGAGTTATTGGAGAAGTAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133375.2-237s1c1
Sequence:CCGGGCGTCATGATTGCATTCTCTTCTCGAGAAGAGAATGCAATCATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133375.2-332s1c1
Sequence:CCGGGCATATACAACGCAGCTGTTTCTCGAGAAACAGCTGCGTTGTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133375.2-2248s1c1
Sequence:CCGGGAGTTCCATCATTACGGTCTTCTCGAGAAGACCGTAATGATGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133375.2-3173s1c1
Sequence:CCGGCTGGGTAGCTATTTCGCATATCTCGAGATATGCGAAATAGCTACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133375
VALIDATED
DIS3L MISSION shRNA Lentiviral Transduction Particles
DIS3 mitotic control homolog (S. cerevisiae)-like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_133375.3-1502s21c1
Sequence:CCGGGAACAAGGGCCACCACTTATTCTCGAGAATAAGTGGTGGCCCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133375.3-1660s21c1
Sequence:CCGGTGGTATGGCAGAACCATTATTCTCGAGAATAATGGTTCTGCCATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_133375.3-368s21c1
Sequence:CCGGACGCAGCTGTTTGGTACTATCCTCGAGGATAGTACCAAACAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_133375.3-3200s21c1
Sequence:CCGGCTGGGTAGCTATTTCGCATATCTCGAGATATGCGAAATAGCTACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_133375.3-2555s21c1
Sequence:CCGGGCATATCTGACGGAGTTATTTCTCGAGAAATAACTCCGTCAGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133375.2-934s1c1
Sequence:CCGGCGGGATTATGTGGTGACATTTCTCGAGAAATGTCACCACATAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133375.2-504s1c1
Sequence:CCGGCCACGAGCTTTGTGATTCTATCTCGAGATAGAATCACAAAGCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150758    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133375.2-3092s1c1
Sequence:CCGGGAGCTGTCATATGTGAATGTTCTCGAGAACATTCACATATGACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133375.2-2285s1c1
Sequence:CCGGCCCACTTTACTTCTCCAATAACTCGAGTTATTGGAGAAGTAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133375.2-237s1c1
Sequence:CCGGGCGTCATGATTGCATTCTCTTCTCGAGAAGAGAATGCAATCATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133375.2-332s1c1
Sequence:CCGGGCATATACAACGCAGCTGTTTCTCGAGAAACAGCTGCGTTGTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133375.2-2248s1c1
Sequence:CCGGGAGTTCCATCATTACGGTCTTCTCGAGAAGACCGTAATGATGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133375.2-3173s1c1
Sequence:CCGGCTGGGTAGCTATTTCGCATATCTCGAGATATGCGAAATAGCTACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001295
VALIDATED
DIS3L MISSION shRNA Bacterial Glycerol Stock
DIS3 mitotic control homolog (S. cerevisiae)-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001295.1-1805s1c1
Sequence:CCGGCCGATCAGCTTACAAACTGTTCTCGAGAACAGTTTGTAAGCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001295.1-2677s1c1
Sequence:CCGGGCTGCATAGCTGATGGAGTTACTCGAGTAACTCCATCAGCTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001295.1-1086s1c1
Sequence:CCGGCGAGATTATGTGGTGACATTTCTCGAGAAATGTCACCACATAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001295.1-1837s1c1
Sequence:CCGGCCCAGGAACTACTGGACGGAACTCGAGTTCCGTCCAGTAGTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001295
VALIDATED
DIS3L MISSION shRNA shRNA Plasmid DNA
DIS3 mitotic control homolog (S. cerevisiae)-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001295.1-1805s1c1
Sequence:CCGGCCGATCAGCTTACAAACTGTTCTCGAGAACAGTTTGTAAGCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001295.1-2677s1c1
Sequence:CCGGGCTGCATAGCTGATGGAGTTACTCGAGTAACTCCATCAGCTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001295.1-1086s1c1
Sequence:CCGGCGAGATTATGTGGTGACATTTCTCGAGAAATGTCACCACATAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001295.1-1837s1c1
Sequence:CCGGCCCAGGAACTACTGGACGGAACTCGAGTTCCGTCCAGTAGTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001295
VALIDATED
DIS3L MISSION shRNA Lentiviral Transduction Particles
DIS3 mitotic control homolog (S. cerevisiae)-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001295.1-1805s1c1
Sequence:CCGGCCGATCAGCTTACAAACTGTTCTCGAGAACAGTTTGTAAGCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001295.1-2677s1c1
Sequence:CCGGGCTGCATAGCTGATGGAGTTACTCGAGTAACTCCATCAGCTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001295.1-1086s1c1
Sequence:CCGGCGAGATTATGTGGTGACATTTCTCGAGAAATGTCACCACATAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001295.1-1837s1c1
Sequence:CCGGCCCAGGAACTACTGGACGGAACTCGAGTTCCGTCCAGTAGTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks