EMAIL THIS PAGE TO A FRIEND

DISC1

disrupted in schizophrenia 1

201 Gene Product Result for
Synonyms: C1orf136 SCZD9
Gene ID:
Human(27185) Summary: This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(244667) disrupted in schizophrenia 1
Rat(307940) disrupted in schizophrenia 1
Zebrafish(407621) disrupted in schizophrenia 1
dog(488970) disrupted in schizophrenia 1
chicken(100859633) disrupted in schizophrenia 1
domestic cat(101089719) disrupted in schizophrenia 1
cow(613555) disrupted in schizophrenia 1
Horse(100060246) disrupted in schizophrenia 1
naked mole-rat(101709649) disrupted in schizophrenia 1
domestic guinea pig(100727415) disrupted in schizophrenia 1
sheep(101114672) disrupted in schizophrenia 1
Domestic Rabbit(100356059) disrupted in schizophrenia 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018662 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012957 Rosetta Predictions human pricing
NM_001012958 Rosetta Predictions human pricing
NM_001012959 Rosetta Predictions human pricing
NM_018662 Rosetta Predictions human pricing
NM_175596 Rosetta Predictions rat pricing
NM_170596 Rosetta Predictions mouse pricing
NM_174853 Rosetta Predictions mouse pricing
NM_174854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239303 predicted 844
2 SASI_Hs01_00239304 predicted 654
3 SASI_Hs01_00239305 predicted 821
4 SASI_Hs01_00239306 predicted 678
5 SASI_Hs01_00239307 predicted 428
6 SASI_Hs01_00239308 predicted 679
7 SASI_Hs01_00239309 predicted 579
8 SASI_Hs01_00239310 predicted 657
9 SASI_Hs01_00239311 predicted 585
10 SASI_Hs01_00239312 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057403 predicted 840
2 SASI_Hs01_00057404 predicted 662
3 SASI_Hs01_00057405 predicted 825
4 SASI_Hs01_00057406 predicted 673
5 SASI_Hs01_00057407 predicted 422
6 SASI_Hs01_00057408 predicted 684
7 SASI_Hs01_00057409 predicted 576
8 SASI_Hs01_00057410 predicted 659
9 SASI_Hs01_00057411 predicted 583
10 SASI_Hs01_00057412 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217949 predicted 843
2 SASI_Hs01_00217950 predicted 659
3 SASI_Hs01_00217951 predicted 825
4 SASI_Hs01_00217952 predicted 675
5 SASI_Hs01_00217953 predicted 430
6 SASI_Hs01_00217954 predicted 684
7 SASI_Hs01_00217955 predicted 578
8 SASI_Hs01_00217956 predicted 653
9 SASI_Hs01_00217957 predicted 588
10 SASI_Hs01_00217958 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124876 predicted 843
2 SASI_Hs01_00124877 predicted 654
3 SASI_Hs01_00124878 predicted 822
4 SASI_Hs01_00124879 predicted 676
5 SASI_Hs01_00124880 predicted 430
6 SASI_Hs01_00124881 predicted 681
7 SASI_Hs01_00124882 predicted 576
8 SASI_Hs01_00124883 predicted 651
9 SASI_Hs01_00124884 predicted 587
10 SASI_Hs01_00124885 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036225 predicted 1079
2 SASI_Rn01_00036226 predicted 380
3 SASI_Rn01_00036227 predicted 1967
4 SASI_Rn01_00036228 predicted 1346
5 SASI_Rn01_00036229 predicted 1651
6 SASI_Rn01_00036230 predicted 274
7 SASI_Rn01_00036231 predicted 1108
8 SASI_Rn01_00036233 predicted 2246
9 SASI_Rn01_00036234 predicted 268
10 SASI_Rn02_00269496 predicted 354
11 SASI_Rn01_00036232 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167206 predicted 1248
2 SASI_Mm01_00167207 predicted 1359
3 SASI_Mm01_00167208 predicted 1132
4 SASI_Mm01_00167209 predicted 492
5 SASI_Mm01_00167210 predicted 418
6 SASI_Mm01_00167211 predicted 1148
7 SASI_Mm01_00167212 predicted 1298
8 SASI_Mm01_00167213 predicted 1299
9 SASI_Mm01_00167214 predicted 1188
10 SASI_Mm01_00167215 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048913 predicted 500
2 SASI_Mm02_00345505 predicted 2156
3 SASI_Mm02_00345506 predicted 424
4 SASI_Mm01_00048916 predicted 1153
5 SASI_Mm01_00048918 predicted 1261
6 SASI_Mm01_00048919 predicted 2164
7 SASI_Mm01_00048920 predicted 1140
8 SASI_Mm01_00048922 predicted 2148
9 SASI_Mm02_00345507 predicted 2147
10 SASI_Mm02_00345508 predicted 1445
11 SASI_Mm01_00048914 predicted 433
12 SASI_Mm01_00048915 predicted 2404
13 SASI_Mm01_00048917 predicted 2310
14 SASI_Mm01_00048921 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127352 predicted 499
2 SASI_Mm02_00345509 predicted 2341
3 SASI_Mm02_00345510 predicted 423
4 SASI_Mm01_00127355 predicted 1150
5 SASI_Mm01_00127357 predicted 1262
6 SASI_Mm01_00127358 predicted 2352
7 SASI_Mm01_00127359 predicted 1131
8 SASI_Mm01_00127361 predicted 2344
9 SASI_Mm02_00345511 predicted 2335
10 SASI_Mm02_00345512 predicted 1450
11 SASI_Mm01_00127353 predicted 425
12 SASI_Mm01_00127354 predicted 2596
13 SASI_Mm01_00127356 predicted 2499
14 SASI_Mm01_00127360 predicted 1398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018662
VALIDATED
DISC1 MISSION shRNA Bacterial Glycerol Stock
disrupted in schizophrenia 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018662.1-1876s1c1
Sequence:CCGGCCGAGGAGATTAGATCATTAACTCGAGTTAATGATCTAATCTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018662.1-1143s1c1
Sequence:CCGGGCAGTTGAGAATGATGATTATCTCGAGATAATCATCATTCTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018662.1-2148s1c1
Sequence:CCGGCGATTGCTTATCCAGTGCCTACTCGAGTAGGCACTGGATAAGCAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018662.1-2405s1c1
Sequence:CCGGCATAGGCAAGAAGCTATTGTACTCGAGTACAATAGCTTCTTGCCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018662.1-1173s1c1
Sequence:CCGGGAGACGTTACAACAAAGATTACTCGAGTAATCTTTGTTGTAACGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018662
VALIDATED
DISC1 MISSION shRNA shRNA Plasmid DNA
disrupted in schizophrenia 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018662.1-1876s1c1
Sequence:CCGGCCGAGGAGATTAGATCATTAACTCGAGTTAATGATCTAATCTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018662.1-1143s1c1
Sequence:CCGGGCAGTTGAGAATGATGATTATCTCGAGATAATCATCATTCTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018662.1-2148s1c1
Sequence:CCGGCGATTGCTTATCCAGTGCCTACTCGAGTAGGCACTGGATAAGCAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018662.1-2405s1c1
Sequence:CCGGCATAGGCAAGAAGCTATTGTACTCGAGTACAATAGCTTCTTGCCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018662.1-1173s1c1
Sequence:CCGGGAGACGTTACAACAAAGATTACTCGAGTAATCTTTGTTGTAACGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018662
VALIDATED
DISC1 MISSION shRNA Lentiviral Transduction Particles
disrupted in schizophrenia 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018662.1-1876s1c1
Sequence:CCGGCCGAGGAGATTAGATCATTAACTCGAGTTAATGATCTAATCTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018662.1-1143s1c1
Sequence:CCGGGCAGTTGAGAATGATGATTATCTCGAGATAATCATCATTCTCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018662.1-2148s1c1
Sequence:CCGGCGATTGCTTATCCAGTGCCTACTCGAGTAGGCACTGGATAAGCAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018662.1-2405s1c1
Sequence:CCGGCATAGGCAAGAAGCTATTGTACTCGAGTACAATAGCTTCTTGCCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018662.1-1173s1c1
Sequence:CCGGGAGACGTTACAACAAAGATTACTCGAGTAATCTTTGTTGTAACGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174854
DISC1 MISSION shRNA Bacterial Glycerol Stock
disrupted in schizophrenia 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174854.1-1389s1c1
Sequence:CCGGGACTGGCTTATTCGAGAGAAACTCGAGTTTCTCTCGAATAAGCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174854.1-430s1c1
Sequence:CCGGCCAAGAATGACAGTAGACAATCTCGAGATTGTCTACTGTCATTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174854.1-2785s1c1
Sequence:CCGGGCCTTTATGTTCCAAGGCAATCTCGAGATTGCCTTGGAACATAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174854.1-1076s1c1
Sequence:CCGGGCTGGAGGTCACTTCCTTAATCTCGAGATTAAGGAAGTGACCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174854.1-925s1c1
Sequence:CCGGCCTCGGATACTGTCTTCTCTTCTCGAGAAGAGAAGACAGTATCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174854
DISC1 MISSION shRNA shRNA Plasmid DNA
disrupted in schizophrenia 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174854.1-1389s1c1
Sequence:CCGGGACTGGCTTATTCGAGAGAAACTCGAGTTTCTCTCGAATAAGCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174854.1-430s1c1
Sequence:CCGGCCAAGAATGACAGTAGACAATCTCGAGATTGTCTACTGTCATTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174854.1-2785s1c1
Sequence:CCGGGCCTTTATGTTCCAAGGCAATCTCGAGATTGCCTTGGAACATAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174854.1-1076s1c1
Sequence:CCGGGCTGGAGGTCACTTCCTTAATCTCGAGATTAAGGAAGTGACCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174854.1-925s1c1
Sequence:CCGGCCTCGGATACTGTCTTCTCTTCTCGAGAAGAGAAGACAGTATCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174854
DISC1 MISSION shRNA Lentiviral Transduction Particles
disrupted in schizophrenia 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174854.1-1389s1c1
Sequence:CCGGGACTGGCTTATTCGAGAGAAACTCGAGTTTCTCTCGAATAAGCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174854.1-430s1c1
Sequence:CCGGCCAAGAATGACAGTAGACAATCTCGAGATTGTCTACTGTCATTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174854.1-2785s1c1
Sequence:CCGGGCCTTTATGTTCCAAGGCAATCTCGAGATTGCCTTGGAACATAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174854.1-1076s1c1
Sequence:CCGGGCTGGAGGTCACTTCCTTAATCTCGAGATTAAGGAAGTGACCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174854.1-925s1c1
Sequence:CCGGCCTCGGATACTGTCTTCTCTTCTCGAGAAGAGAAGACAGTATCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)