EMAIL THIS PAGE TO A FRIEND

DISP1

dispatched homolog 1 (Drosophila)

Synonyms: DISPA
UniProtKB ID: Q96F81, Q8N7C2, Q96I92, Q9H698, Q9H8H9, Q9UFA2
Gene ID:
Human(84976) Summary: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
Mouse(68897) dispatched homolog 1 (Drosophila)
Rat(289338) dispatched homolog 1 (Drosophila)
Zebrafish(619201) dispatched homolog 1 (Drosophila)
cow(534637) dispatched homolog 1 (Drosophila)
Horse(100049844) dispatched homolog 1 (Drosophila)
domestic cat(101081946) dispatched homolog 1 (Drosophila)
dog(488604) dispatched homolog 1 (Drosophila)
chicken(421333) dispatched homolog 1 (Drosophila)
sheep(101107807) dispatched homolog 1 (Drosophila)
Domestic Rabbit(100350276) dispatched homolog 1 (Drosophila)
domestic guinea pig(100712942) dispatched homolog 1 (Drosophila)
naked mole-rat(101718667) dispatched homolog 1 (Drosophila)
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032890 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032890 Rosetta Predictions human pricing
NM_001105983 Rosetta Predictions rat pricing
NM_026866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360509 predicted 3973
2 SASI_Hs02_00360510 predicted 1724
3 SASI_Hs01_00162192 predicted 2543
4 SASI_Hs02_00360511 predicted 3253
5 SASI_Hs02_00360512 predicted 4267
6 SASI_Hs02_00360513 predicted 836
7 SASI_Hs01_00162194 predicted 1038
8 SASI_Hs02_00360514 predicted 2643
9 SASI_Hs01_00162195 predicted 2432
10 SASI_Hs01_00162198 predicted 1203
11 SASI_Hs01_00162190 predicted 505
12 SASI_Hs01_00162191 predicted 1076
13 SASI_Hs01_00162193 predicted 419
14 SASI_Hs01_00162196 predicted 1789
15 SASI_Hs01_00162197 predicted 2915
16 SASI_Hs01_00162199 predicted 1602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214472 predicted 4299
2 SASI_Rn02_00214473 predicted 4436
3 SASI_Rn02_00214474 predicted 1830
4 SASI_Rn02_00214475 predicted 2626
5 SASI_Rn02_00214476 predicted 779
6 SASI_Rn02_00214477 predicted 3239
7 SASI_Rn02_00214478 predicted 4064
8 SASI_Rn02_00214479 predicted 760
9 SASI_Rn02_00214480 predicted 2727
10 SASI_Rn02_00214481 predicted 2172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046657 predicted 2857
2 SASI_Mm02_00331089 predicted 2711
3 SASI_Mm02_00331090 predicted 1967
4 SASI_Mm01_00046660 predicted 4796
5 SASI_Mm01_00046661 predicted 4303
6 SASI_Mm01_00046662 predicted 4761
7 SASI_Mm01_00046664 predicted 2625
8 SASI_Mm01_00046665 predicted 1989
9 SASI_Mm01_00046666 predicted 586
10 SASI_Mm02_00331091 predicted 4789
11 SASI_Mm01_00046658 predicted 2862
12 SASI_Mm01_00046659 predicted 3337
13 SASI_Mm01_00046663 predicted 501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026866
DISP1 MISSION shRNA Bacterial Glycerol Stock
dispatched homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026866.1-1290s1c1
Sequence:CCGGCGATGTGTGATGTGGATAATTCTCGAGAATTATCCACATCACACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026866.1-3748s1c1
Sequence:CCGGCCAGATCCCTTTCCCTACAAACTCGAGTTTGTAGGGAAAGGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-3438s21c1
Sequence:CCGGCCACGTGGAATATCATCATAACTCGAGTTATGATGATATTCCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-1158s21c1
Sequence:CCGGTGCGAAACACAGGGTACAAAGCTCGAGCTTTGTACCCTGTGTTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-1698s21c1
Sequence:CCGGACAACGCCGTGTACCAGATTCCTCGAGGAATCTGGTACACGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026866.2-4263s1c1
Sequence:CCGGCACACTTACAGTACGGATTACCTCGAGGTAATCCGTACTGTAAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-1376s21c1
Sequence:CCGGTGGAATTTACCTGCAATTAAGCTCGAGCTTAATTGCAGGTAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-2068s21c1
Sequence:CCGGCCTCTACCGAGTCGTCTTTAACTCGAGTTAAAGACGACTCGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026866
DISP1 MISSION shRNA shRNA Plasmid DNA
dispatched homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026866.1-1290s1c1
Sequence:CCGGCGATGTGTGATGTGGATAATTCTCGAGAATTATCCACATCACACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026866.1-3748s1c1
Sequence:CCGGCCAGATCCCTTTCCCTACAAACTCGAGTTTGTAGGGAAAGGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-3438s21c1
Sequence:CCGGCCACGTGGAATATCATCATAACTCGAGTTATGATGATATTCCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-1158s21c1
Sequence:CCGGTGCGAAACACAGGGTACAAAGCTCGAGCTTTGTACCCTGTGTTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-1698s21c1
Sequence:CCGGACAACGCCGTGTACCAGATTCCTCGAGGAATCTGGTACACGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026866.2-4263s1c1
Sequence:CCGGCACACTTACAGTACGGATTACCTCGAGGTAATCCGTACTGTAAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-1376s21c1
Sequence:CCGGTGGAATTTACCTGCAATTAAGCTCGAGCTTAATTGCAGGTAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-2068s21c1
Sequence:CCGGCCTCTACCGAGTCGTCTTTAACTCGAGTTAAAGACGACTCGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026866
DISP1 MISSION shRNA Lentiviral Transduction Particles
dispatched homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026866.1-1290s1c1
Sequence:CCGGCGATGTGTGATGTGGATAATTCTCGAGAATTATCCACATCACACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026866.1-3748s1c1
Sequence:CCGGCCAGATCCCTTTCCCTACAAACTCGAGTTTGTAGGGAAAGGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-3438s21c1
Sequence:CCGGCCACGTGGAATATCATCATAACTCGAGTTATGATGATATTCCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-1158s21c1
Sequence:CCGGTGCGAAACACAGGGTACAAAGCTCGAGCTTTGTACCCTGTGTTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-1698s21c1
Sequence:CCGGACAACGCCGTGTACCAGATTCCTCGAGGAATCTGGTACACGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026866.2-4263s1c1
Sequence:CCGGCACACTTACAGTACGGATTACCTCGAGGTAATCCGTACTGTAAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-1376s21c1
Sequence:CCGGTGGAATTTACCTGCAATTAAGCTCGAGCTTAATTGCAGGTAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026866.2-2068s21c1
Sequence:CCGGCCTCTACCGAGTCGTCTTTAACTCGAGTTAAAGACGACTCGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032890
VALIDATED
DISP1 MISSION shRNA Bacterial Glycerol Stock
dispatched homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-1380s21c1
Sequence:CCGGCACCAATGTGCCACGCAAATGCTCGAGCATTTGCGTGGCACATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-951s21c1
Sequence:CCGGTAGATGGTCAGATGATCATTACTCGAGTAATGATCATCTGACCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-1789s21c1
Sequence:CCGGGTAGTATTTCACTTCGAATTTCTCGAGAAATTCGAAGTGAAATACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-1087s21c1
Sequence:CCGGTGGAATTTACCTGCAATTAAACTCGAGTTTAATTGCAGGTAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-3190s21c1
Sequence:CCGGTCAATTGCTGGAACGATATTTCTCGAGAAATATCGTTCCAGCAATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-754s21c1
Sequence:CCGGTGTGCCTTGGTTGGAGTATTACTCGAGTAATACTCCAACCAAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-1028s21c1
Sequence:CCGGACGTTCCAAGTGACCGATATTCTCGAGAATATCGGTCACTTGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-3296s21c1
Sequence:CCGGTAGACTTTGCCGTCCATTATGCTCGAGCATAATGGACGGCAAAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-4309s21c1
Sequence:CCGGATGGCAGAGCCATCGTCATTTCTCGAGAAATGACGATGGCTCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-2536s21c1
Sequence:CCGGGACAATGGCAACCCACTAAATCTCGAGATTTAGTGGGTTGCCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032890
VALIDATED
DISP1 MISSION shRNA shRNA Plasmid DNA
dispatched homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-1380s21c1
Sequence:CCGGCACCAATGTGCCACGCAAATGCTCGAGCATTTGCGTGGCACATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-951s21c1
Sequence:CCGGTAGATGGTCAGATGATCATTACTCGAGTAATGATCATCTGACCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-1789s21c1
Sequence:CCGGGTAGTATTTCACTTCGAATTTCTCGAGAAATTCGAAGTGAAATACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-1087s21c1
Sequence:CCGGTGGAATTTACCTGCAATTAAACTCGAGTTTAATTGCAGGTAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-3190s21c1
Sequence:CCGGTCAATTGCTGGAACGATATTTCTCGAGAAATATCGTTCCAGCAATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-754s21c1
Sequence:CCGGTGTGCCTTGGTTGGAGTATTACTCGAGTAATACTCCAACCAAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-1028s21c1
Sequence:CCGGACGTTCCAAGTGACCGATATTCTCGAGAATATCGGTCACTTGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-3296s21c1
Sequence:CCGGTAGACTTTGCCGTCCATTATGCTCGAGCATAATGGACGGCAAAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-4309s21c1
Sequence:CCGGATGGCAGAGCCATCGTCATTTCTCGAGAAATGACGATGGCTCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-2536s21c1
Sequence:CCGGGACAATGGCAACCCACTAAATCTCGAGATTTAGTGGGTTGCCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032890
VALIDATED
DISP1 MISSION shRNA Lentiviral Transduction Particles
dispatched homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-1380s21c1
Sequence:CCGGCACCAATGTGCCACGCAAATGCTCGAGCATTTGCGTGGCACATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-951s21c1
Sequence:CCGGTAGATGGTCAGATGATCATTACTCGAGTAATGATCATCTGACCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-1789s21c1
Sequence:CCGGGTAGTATTTCACTTCGAATTTCTCGAGAAATTCGAAGTGAAATACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-1087s21c1
Sequence:CCGGTGGAATTTACCTGCAATTAAACTCGAGTTTAATTGCAGGTAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-3190s21c1
Sequence:CCGGTCAATTGCTGGAACGATATTTCTCGAGAAATATCGTTCCAGCAATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-754s21c1
Sequence:CCGGTGTGCCTTGGTTGGAGTATTACTCGAGTAATACTCCAACCAAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-1028s21c1
Sequence:CCGGACGTTCCAAGTGACCGATATTCTCGAGAATATCGGTCACTTGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-3296s21c1
Sequence:CCGGTAGACTTTGCCGTCCATTATGCTCGAGCATAATGGACGGCAAAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032890.2-4309s21c1
Sequence:CCGGATGGCAGAGCCATCGTCATTTCTCGAGAAATGACGATGGCTCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032890.2-2536s21c1
Sequence:CCGGGACAATGGCAACCCACTAAATCTCGAGATTTAGTGGGTTGCCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks