EMAIL THIS PAGE TO A FRIEND

DIXDC1

DIX domain containing 1

Synonyms: CCD1
Gene ID:
Human(85458) Summary: The protein encoded by this gene is a positive regulator of the Wnt signaling pathway. The encoded protein is found associated with gamma tubulin at the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Mouse(330938) DIX domain containing 1
Rat(363062) DIX domain containing 1
chicken(419798) DIX domain containing 1
domestic cat(101093709) DIX domain containing 1
dog(608957) DIX domain containing 1
Horse(100061990) DIX domain containing 1
cow(541211) DIX domain containing 1
sheep(101110264) DIX domain containing 1
Domestic Rabbit(100349631) DIX domain containing 1
domestic guinea pig(100716928) DIX domain containing 1
naked mole-rat(101697536) DIX domain containing 1
Gene Class: Cytoskeleton
242 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033425 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_284495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_284495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_284495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037954 Rosetta Predictions human pricing
NM_033425 Rosetta Predictions human pricing
NM_001037654 Rosetta Predictions rat pricing
NM_178118 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223764 predicted 1738
2 SASI_Hs01_00223765 predicted 2353
3 SASI_Hs01_00223766 predicted 1655
4 SASI_Hs01_00223767 predicted 2208
5 SASI_Hs01_00223768 predicted 1200
6 SASI_Hs02_00308384 predicted 2352
7 SASI_Hs01_00223770 predicted 2119
8 SASI_Hs02_00308385 predicted 2186
9 SASI_Hs01_00223771 predicted 1226
10 SASI_Hs01_00223772 predicted 1480
11 SASI_Hs01_00223763 predicted 2190
12 SASI_Hs01_00223769 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050713 predicted 1266
2 SASI_Hs01_00050714 predicted 1888
3 SASI_Hs01_00050715 predicted 1191
4 SASI_Hs01_00050716 predicted 1735
5 SASI_Hs01_00050717 predicted 738
6 SASI_Hs02_00361320 predicted 1884
7 SASI_Hs01_00050719 predicted 1654
8 SASI_Hs02_00361321 predicted 1717
9 SASI_Hs01_00050720 predicted 757
10 SASI_Hs01_00050721 predicted 1006
11 SASI_Hs01_00050712 predicted 1804
12 SASI_Hs01_00050718 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076035 predicted 1799
2 SASI_Rn01_00076037 predicted 689
3 SASI_Rn01_00076038 predicted 1631
4 SASI_Rn01_00076039 predicted 1732
5 SASI_Rn02_00204536 predicted 1193
6 SASI_Rn01_00076040 predicted 1364
7 SASI_Rn01_00076041 predicted 1549
8 SASI_Rn01_00076042 predicted 920
9 SASI_Rn01_00076043 predicted 690
10 SASI_Rn01_00076044 predicted 676
11 SASI_Rn01_00076036 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029700 predicted 883
2 SASI_Mm01_00029701 predicted 2108
3 SASI_Mm01_00029702 predicted 764
4 SASI_Mm01_00029703 predicted 1254
5 SASI_Mm01_00029704 predicted 1953
6 SASI_Mm01_00029705 predicted 1389
7 SASI_Mm02_00348588 predicted 295
8 SASI_Mm02_00348589 predicted 1173
9 SASI_Mm01_00029708 predicted 1545
10 SASI_Mm02_00348590 predicted 386
11 SASI_Mm01_00029706 predicted 436
12 SASI_Mm01_00029707 predicted 1563
13 SASI_Mm01_00029709 predicted 537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033425
DIXDC1 MISSION shRNA Bacterial Glycerol Stock
DIX domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033425.1-2914s1c1
Sequence:CCGGGCAGGGATCATTCTGGGTAAACTCGAGTTTACCCAGAATGATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033425.1-1164s1c1
Sequence:CCGGGAGCGAGAGCTAGAACACAAACTCGAGTTTGTGTTCTAGCTCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033425.1-1686s1c1
Sequence:CCGGGCTATTGATCGGGAAGGAAATCTCGAGATTTCCTTCCCGATCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033425.1-1498s1c1
Sequence:CCGGGAACTCAAGTAGGTAGTGAATCTCGAGATTCACTACCTACTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033425.3-515s21c1
Sequence:CCGGGCAAAGAGCGAGTCCATTATACTCGAGTATAATGGACTCGCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033425.3-1000s21c1
Sequence:CCGGAGAGCTACTGAGGGCAAATATCTCGAGATATTTGCCCTCAGTAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033425
DIXDC1 MISSION shRNA shRNA Plasmid DNA
DIX domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033425.1-2914s1c1
Sequence:CCGGGCAGGGATCATTCTGGGTAAACTCGAGTTTACCCAGAATGATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033425.1-1164s1c1
Sequence:CCGGGAGCGAGAGCTAGAACACAAACTCGAGTTTGTGTTCTAGCTCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033425.1-1686s1c1
Sequence:CCGGGCTATTGATCGGGAAGGAAATCTCGAGATTTCCTTCCCGATCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033425.1-1498s1c1
Sequence:CCGGGAACTCAAGTAGGTAGTGAATCTCGAGATTCACTACCTACTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033425.3-515s21c1
Sequence:CCGGGCAAAGAGCGAGTCCATTATACTCGAGTATAATGGACTCGCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033425.3-1000s21c1
Sequence:CCGGAGAGCTACTGAGGGCAAATATCTCGAGATATTTGCCCTCAGTAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033425
DIXDC1 MISSION shRNA Lentiviral Transduction Particles
DIX domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033425.1-2914s1c1
Sequence:CCGGGCAGGGATCATTCTGGGTAAACTCGAGTTTACCCAGAATGATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033425.1-1164s1c1
Sequence:CCGGGAGCGAGAGCTAGAACACAAACTCGAGTTTGTGTTCTAGCTCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033425.1-1686s1c1
Sequence:CCGGGCTATTGATCGGGAAGGAAATCTCGAGATTTCCTTCCCGATCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033425.1-1498s1c1
Sequence:CCGGGAACTCAAGTAGGTAGTGAATCTCGAGATTCACTACCTACTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033425.3-515s21c1
Sequence:CCGGGCAAAGAGCGAGTCCATTATACTCGAGTATAATGGACTCGCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033425.3-1000s21c1
Sequence:CCGGAGAGCTACTGAGGGCAAATATCTCGAGATATTTGCCCTCAGTAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_284495
DIXDC1 MISSION shRNA Bacterial Glycerol Stock
DIX domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_284495.2-4331s1c1
Sequence:CCGGCCAGGGAGAATGGTGTTCATTCTCGAGAATGAACACCATTCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284495.2-1212s1c1
Sequence:CCGGCCGAGGAACAGCTGATTATAACTCGAGTTATAATCAGCTGTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284495.2-2178s1c1
Sequence:CCGGGCACAGTCAAAGAAGAGGTTTCTCGAGAAACCTCTTCTTTGACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284495.2-1467s1c1
Sequence:CCGGACCGGCTCTTAGGAGAATATACTCGAGTATATTCTCCTAAGAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284495.2-308s1c1
Sequence:CCGGGCCTATCTCATCGAGATTGTTCTCGAGAACAATCTCGATGAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_284495
DIXDC1 MISSION shRNA shRNA Plasmid DNA
DIX domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_284495.2-4331s1c1
Sequence:CCGGCCAGGGAGAATGGTGTTCATTCTCGAGAATGAACACCATTCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284495.2-1212s1c1
Sequence:CCGGCCGAGGAACAGCTGATTATAACTCGAGTTATAATCAGCTGTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284495.2-2178s1c1
Sequence:CCGGGCACAGTCAAAGAAGAGGTTTCTCGAGAAACCTCTTCTTTGACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284495.2-1467s1c1
Sequence:CCGGACCGGCTCTTAGGAGAATATACTCGAGTATATTCTCCTAAGAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284495.2-308s1c1
Sequence:CCGGGCCTATCTCATCGAGATTGTTCTCGAGAACAATCTCGATGAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_284495
DIXDC1 MISSION shRNA Lentiviral Transduction Particles
DIX domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_284495.2-4331s1c1
Sequence:CCGGCCAGGGAGAATGGTGTTCATTCTCGAGAATGAACACCATTCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284495.2-1212s1c1
Sequence:CCGGCCGAGGAACAGCTGATTATAACTCGAGTTATAATCAGCTGTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284495.2-2178s1c1
Sequence:CCGGGCACAGTCAAAGAAGAGGTTTCTCGAGAAACCTCTTCTTTGACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284495.2-1467s1c1
Sequence:CCGGACCGGCTCTTAGGAGAATATACTCGAGTATATTCTCCTAAGAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284495.2-308s1c1
Sequence:CCGGGCCTATCTCATCGAGATTGTTCTCGAGAACAATCTCGATGAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks