EMAIL THIS PAGE TO A FRIEND

DKC1

dyskeratosis congenita 1, dyskerin

60 Gene Product Result for
Synonyms: CBF5 DKC DKCX NAP57 NOLA4 XAP101
UniProtKB ID: O60832, F5BSB3, O43845, Q96G67, Q9Y505
Gene ID:
Human(1736) Summary: This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the NOLA1, 2 and 3 proteins. The protein encoded by this gene and the three NOLA proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. These four H/ACA snoRNP proteins are also components of the telomerase complex. The protein encoded by this gene is related to the Saccharomyces cerevisiae Cbf5p and Drosophila melanogaster Nop60B proteins. The gene lies in a tail-to-tail orientation with the palmitoylated erythrocyte membrane protein gene and is transcribed in a telomere to centromere direction. Both nucleotide substitutions and single trinucleotide repeat polymorphisms have been found in this gene. Mutations in this gene cause X-linked dyskeratosis congenita, a disease resulting in reticulate skin pigmentation, mucosal leukoplakia, nail dystrophy, and progressive bone marrow failure in most cases. Mutations in this gene also cause Hoyeraal-Hreidarsson syndrome, which is a more severe form of dyskeratosis congenita. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
Mouse(245474) dyskeratosis congenita 1, dyskerin
Rat(170944) dyskeratosis congenita 1, dyskerin
Zebrafish(613144) dyskeratosis congenita 1, dyskerin
domestic cat(101096046) dyskeratosis congenita 1, dyskerin
Horse(100062345) dyskeratosis congenita 1, dyskerin
cow(525619) dyskeratosis congenita 1, dyskerin
dog(492263) dyskeratosis congenita 1, dyskerin
chicken(422196) dyskeratosis congenita 1, dyskerin
naked mole-rat(101723640) dyskeratosis congenita 1, dyskerin
domestic guinea pig(100721753) dyskeratosis congenita 1, dyskerin
sheep(100216437) dyskeratosis congenita 1, dyskerin
Domestic Rabbit(100328767) dyskeratosis congenita 1, dyskerin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001363 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001030307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001030307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001030307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001363 Rosetta Predictions human pricing
NM_133419 Rosetta Predictions rat pricing
NM_001030307 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195836 predicted 1001
2 SASI_Hs01_00195837 predicted 717
3 SASI_Hs01_00195838 predicted 350
4 SASI_Hs01_00195839 predicted 278
5 SASI_Hs01_00195840 predicted 919
6 SASI_Hs01_00195841 predicted 293
7 SASI_Hs01_00195843 predicted 712
8 SASI_Hs01_00195845 predicted 221
9 SASI_Hs02_00331709 predicted 1123
10 SASI_Hs02_00331710 predicted 995
11 SASI_Hs01_00195842 predicted 592
12 SASI_Hs01_00195844 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044618 predicted 682
2 SASI_Rn01_00044620 predicted 1003
3 SASI_Rn01_00044621 predicted 1188
4 SASI_Rn01_00044622 predicted 351
5 SASI_Rn01_00044623 predicted 893
6 SASI_Rn01_00044624 predicted 1014
7 SASI_Rn01_00044625 predicted 999
8 SASI_Rn01_00044626 predicted 1069
9 SASI_Rn01_00044627 predicted 478
10 SASI_Rn02_00267676 predicted 337
11 SASI_Rn01_00044619 predicted 1252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144749 predicted 377
2 SASI_Mm01_00144750 predicted 1435
3 SASI_Mm01_00144751 predicted 1009
4 SASI_Mm01_00144752 predicted 517
5 SASI_Mm02_00288136 predicted 298
6 SASI_Mm01_00144753 predicted 818
7 SASI_Mm01_00144754 predicted 399
8 SASI_Mm01_00144755 predicted 875
9 SASI_Mm01_00144756 predicted 919
10 SASI_Mm01_00144757 predicted 1132
11 SASI_Mm01_00144758 predicted 1067
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001363
VALIDATED
DKC1 MISSION shRNA Bacterial Glycerol Stock
dyskeratosis congenita 1, dyskerin
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001363.3-1456s21c1
Sequence:CCGGTATGTTGACTACAGTGAGTCTCTCGAGAGACTCACTGTAGTCAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001363.3-306s21c1
Sequence:CCGGCGCTGAAGAATTTCTTATCAACTCGAGTTGATAAGAAATTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001363.3-2142s21c1
Sequence:CCGGGCTCAGTGAAATGCTGTAGAACTCGAGTTCTACAGCATTTCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001363.3-682s21c1
Sequence:CCGGCGGCTGCACAATGCTATTGAACTCGAGTTCAATAGCATTGTGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001363.3-877s21c1
Sequence:CCGGGGCACCTACATTCGGACATTACTCGAGTAATGTCCGAATGTAGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001363.2-2024s1c1
Sequence:CCGGGCTCAGTGAAATGCTGTAGAACTCGAGTTCTACAGCATTTCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001363.2-188s1c1
Sequence:CCGGCGCTGAAGAATTTCTTATCAACTCGAGTTGATAAGAAATTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001363.2-147s1c1
Sequence:CCGGCGGAAGTCATTGCCAGAAGAACTCGAGTTCTTCTGGCAATGACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001363.x-294s1c1
Sequence:CCGGCACTATACACCTCTTGCATGTCTCGAGACATGCAAGAGGTGTATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001363.x-1338s1c1
Sequence:CCGGTATGTTGACTACAGTGAGTCTCTCGAGAGACTCACTGTAGTCAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001363.x-1784s1c1
Sequence:CCGGATGTTACCTGGTGTGGTCATCTCGAGATGACCACACCAGGTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001363
VALIDATED
DKC1 MISSION shRNA shRNA Plasmid DNA
dyskeratosis congenita 1, dyskerin
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001363.3-1456s21c1
Sequence:CCGGTATGTTGACTACAGTGAGTCTCTCGAGAGACTCACTGTAGTCAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001363.3-306s21c1
Sequence:CCGGCGCTGAAGAATTTCTTATCAACTCGAGTTGATAAGAAATTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001363.3-2142s21c1
Sequence:CCGGGCTCAGTGAAATGCTGTAGAACTCGAGTTCTACAGCATTTCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001363.3-682s21c1
Sequence:CCGGCGGCTGCACAATGCTATTGAACTCGAGTTCAATAGCATTGTGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001363.3-877s21c1
Sequence:CCGGGGCACCTACATTCGGACATTACTCGAGTAATGTCCGAATGTAGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001363.2-2024s1c1
Sequence:CCGGGCTCAGTGAAATGCTGTAGAACTCGAGTTCTACAGCATTTCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001363.2-188s1c1
Sequence:CCGGCGCTGAAGAATTTCTTATCAACTCGAGTTGATAAGAAATTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001363.2-147s1c1
Sequence:CCGGCGGAAGTCATTGCCAGAAGAACTCGAGTTCTTCTGGCAATGACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001363.x-294s1c1
Sequence:CCGGCACTATACACCTCTTGCATGTCTCGAGACATGCAAGAGGTGTATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001363.x-1338s1c1
Sequence:CCGGTATGTTGACTACAGTGAGTCTCTCGAGAGACTCACTGTAGTCAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001363.x-1784s1c1
Sequence:CCGGATGTTACCTGGTGTGGTCATCTCGAGATGACCACACCAGGTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001363
VALIDATED
DKC1 MISSION shRNA Lentiviral Transduction Particles
dyskeratosis congenita 1, dyskerin
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001363.3-1456s21c1
Sequence:CCGGTATGTTGACTACAGTGAGTCTCTCGAGAGACTCACTGTAGTCAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001363.3-306s21c1
Sequence:CCGGCGCTGAAGAATTTCTTATCAACTCGAGTTGATAAGAAATTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001363.3-2142s21c1
Sequence:CCGGGCTCAGTGAAATGCTGTAGAACTCGAGTTCTACAGCATTTCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001363.3-682s21c1
Sequence:CCGGCGGCTGCACAATGCTATTGAACTCGAGTTCAATAGCATTGTGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001363.3-877s21c1
Sequence:CCGGGGCACCTACATTCGGACATTACTCGAGTAATGTCCGAATGTAGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001363.2-2024s1c1
Sequence:CCGGGCTCAGTGAAATGCTGTAGAACTCGAGTTCTACAGCATTTCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001363.2-188s1c1
Sequence:CCGGCGCTGAAGAATTTCTTATCAACTCGAGTTGATAAGAAATTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001363.2-147s1c1
Sequence:CCGGCGGAAGTCATTGCCAGAAGAACTCGAGTTCTTCTGGCAATGACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001363.x-294s1c1
Sequence:CCGGCACTATACACCTCTTGCATGTCTCGAGACATGCAAGAGGTGTATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001363.x-1338s1c1
Sequence:CCGGTATGTTGACTACAGTGAGTCTCTCGAGAGACTCACTGTAGTCAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001363.x-1784s1c1
Sequence:CCGGATGTTACCTGGTGTGGTCATCTCGAGATGACCACACCAGGTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001030307
VALIDATED
DKC1 MISSION shRNA Bacterial Glycerol Stock
dyskeratosis congenita 1, dyskerin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030307.1-453s21c1
Sequence:GTACCGGATATCAGGACCGGTTTCATTACTCGAGTAATGAAACCGGTCCTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030307.1-266s21c1
Sequence:GTACCGGGAAGATGATGTTGCCGAAATACTCGAGTATTTCGGCAACATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030307.1-512s21c1
Sequence:CCGGGTAGCCTGGATCCGACGAATACTCGAGTATTCGTCGGATCCAGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001030307.1-1995s21c1
Sequence:CCGGGTAACTATCTGCAGCTATTTACTCGAGTAAATAGCTGCAGATAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030307.1-865s21c1
Sequence:CCGGCACCTACATTCGGACACTATGCTCGAGCATAGTGTCCGAATGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001030307
VALIDATED
DKC1 MISSION shRNA shRNA Plasmid DNA
dyskeratosis congenita 1, dyskerin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030307.1-453s21c1
Sequence:GTACCGGATATCAGGACCGGTTTCATTACTCGAGTAATGAAACCGGTCCTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030307.1-266s21c1
Sequence:GTACCGGGAAGATGATGTTGCCGAAATACTCGAGTATTTCGGCAACATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030307.1-512s21c1
Sequence:CCGGGTAGCCTGGATCCGACGAATACTCGAGTATTCGTCGGATCCAGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001030307.1-1995s21c1
Sequence:CCGGGTAACTATCTGCAGCTATTTACTCGAGTAAATAGCTGCAGATAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030307.1-865s21c1
Sequence:CCGGCACCTACATTCGGACACTATGCTCGAGCATAGTGTCCGAATGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001030307
VALIDATED
DKC1 MISSION shRNA Lentiviral Transduction Particles
dyskeratosis congenita 1, dyskerin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030307.1-453s21c1
Sequence:GTACCGGATATCAGGACCGGTTTCATTACTCGAGTAATGAAACCGGTCCTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030307.1-266s21c1
Sequence:GTACCGGGAAGATGATGTTGCCGAAATACTCGAGTATTTCGGCAACATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001030307.1-512s21c1
Sequence:CCGGGTAGCCTGGATCCGACGAATACTCGAGTATTCGTCGGATCCAGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001030307.1-1995s21c1
Sequence:CCGGGTAACTATCTGCAGCTATTTACTCGAGTAAATAGCTGCAGATAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030307.1-865s21c1
Sequence:CCGGCACCTACATTCGGACACTATGCTCGAGCATAGTGTCCGAATGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks