EMAIL THIS PAGE TO A FRIEND

DKFZp451A211

30 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003399 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003399 Rosetta Predictions human pricing
XR_041296 Rosetta Predictions human pricing
XR_041297 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085816 predicted 2618
2 SASI_Hs01_00085817 predicted 564
3 SASI_Hs01_00085818 predicted 810
4 SASI_Hs01_00085819 predicted 2918
5 SASI_Hs01_00085820 predicted 2500
6 SASI_Hs01_00085821 predicted 530
7 SASI_Hs01_00085822 predicted 1776
8 SASI_Hs01_00085823 predicted 2427
9 SASI_Hs01_00085824 predicted 2889
10 SASI_Hs01_00085825 predicted 2366
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526204 predicted 7321
2 SASI_Hs02_00526205 predicted 5205
3 SASI_Hs02_00526206 predicted 1313
4 SASI_Hs02_00526207 predicted 7349
5 SASI_Hs02_00526208 predicted 6185
6 SASI_Hs02_00526209 predicted 5087
7 SASI_Hs02_00526210 predicted 7457
8 SASI_Hs02_00526211 predicted 5971
9 SASI_Hs02_00526212 predicted 6652
10 SASI_Hs02_00526213 predicted 6155
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526214 predicted 5696
2 SASI_Hs02_00526215 predicted 3570
3 SASI_Hs02_00526216 predicted 5717
4 SASI_Hs02_00526217 predicted 4559
5 SASI_Hs02_00526218 predicted 3452
6 SASI_Hs02_00526219 predicted 5831
7 SASI_Hs02_00526220 predicted 4346
8 SASI_Hs02_00526221 predicted 5025
9 SASI_Hs02_00526222 predicted 4526
10 SASI_Hs02_00526223 predicted 6065
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003399
DKFZp451A211 MISSION shRNA Bacterial Glycerol Stock
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000173006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003399.1-3122s1c1
Sequence:CCGGGCCCACGTTAAGTTCTGAGAACTCGAGTTCTCAGAACTTAACGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003399.1-5126s1c1
Sequence:CCGGCCAGTGACTTCACCAGGATTTCTCGAGAAATCCTGGTGAAGTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003399.1-2351s1c1
Sequence:CCGGCAAGTACAAAGCCCAGAGCTTCTCGAGAAGCTCTGGGCTTTGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003399
DKFZp451A211 MISSION shRNA shRNA Plasmid DNA
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000173006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003399.1-3122s1c1
Sequence:CCGGGCCCACGTTAAGTTCTGAGAACTCGAGTTCTCAGAACTTAACGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003399.1-5126s1c1
Sequence:CCGGCCAGTGACTTCACCAGGATTTCTCGAGAAATCCTGGTGAAGTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003399.1-2351s1c1
Sequence:CCGGCAAGTACAAAGCCCAGAGCTTCTCGAGAAGCTCTGGGCTTTGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003399
DKFZp451A211 MISSION shRNA Lentiviral Transduction Particles
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000173006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003399.1-3122s1c1
Sequence:CCGGGCCCACGTTAAGTTCTGAGAACTCGAGTTCTCAGAACTTAACGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003399.1-5126s1c1
Sequence:CCGGCCAGTGACTTCACCAGGATTTCTCGAGAAATCCTGGTGAAGTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003399.1-2351s1c1
Sequence:CCGGCAAGTACAAAGCCCAGAGCTTCTCGAGAAGCTCTGGGCTTTGTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)