EMAIL THIS PAGE TO A FRIEND

DKK1

dickkopf WNT signaling pathway inhibitor 1

110 Gene Product Result for
Synonyms: DKK-1 SK
UniProtKB ID: O94907, B2RC19
Gene ID:
Human(22943) Summary: This gene encodes a protein that is a member of the dickkopf family. It is a secreted protein with two cysteine rich regions and is involved in embryonic development through its inhibition of the WNT signaling pathway. Elevated levels of DKK1 in bone marrow plasma and peripheral blood is associated with the presence of osteolytic bone lesions in patients with multiple myeloma. [provided by RefSeq, Jul 2008]
Mouse(13380) dickkopf homolog 1 (Xenopus laevis)
Rat(293897) dickkopf WNT signaling pathway inhibitor 1
chicken(374156) dickkopf homolog 1 (Xenopus laevis)
dog(609600) dickkopf 1 homolog (Xenopus laevis)
domestic cat(101097173) dickkopf 1 homolog (Xenopus laevis)
cow(504445) dickkopf homolog 1 (Xenopus laevis)
Horse(100071881) dickkopf 1 homolog (Xenopus laevis)
sheep(101116876) dickkopf 1 homolog (Xenopus laevis)
Domestic Rabbit(100009504) dickkopf 1 homolog (Xenopus laevis)
domestic guinea pig(100731485) dickkopf WNT signaling pathway inhibitor 1
naked mole-rat(101706794) dickkopf WNT signaling pathway inhibitor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012242 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010051 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010051 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010051 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035311 MISSION® esiRNA esiRNA human DKK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012242 Rosetta Predictions human pricing
NM_001106350 Rosetta Predictions rat pricing
NM_010051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140891 predicted 947
2 SASI_Hs01_00140892 predicted 1028
3 SASI_Hs01_00140893 predicted 775
4 SASI_Hs02_00343936 predicted 960
5 SASI_Hs01_00140894 predicted 915
6 SASI_Hs01_00140895 predicted 467
7 SASI_Hs01_00140896 predicted 616
8 SASI_Hs01_00140898 predicted 906
9 SASI_Hs01_00140899 predicted 836
10 SASI_Hs01_00140900 predicted 601
11 SASI_Hs01_00140897 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218108 predicted 1085
2 SASI_Rn02_00218109 predicted 1154
3 SASI_Rn02_00218110 predicted 1218
4 SASI_Rn02_00218111 predicted 1129
5 SASI_Rn02_00218112 predicted 239
6 SASI_Rn02_00218113 predicted 1041
7 SASI_Rn02_00218114 predicted 1113
8 SASI_Rn02_00218115 predicted 745
9 SASI_Rn02_00218116 predicted 889
10 SASI_Rn02_00218117 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068213 predicted 923
2 SASI_Mm02_00317693 predicted 742
3 SASI_Mm01_00068214 predicted 883
4 SASI_Mm01_00068215 predicted 217
5 SASI_Mm01_00068216 predicted 923
6 SASI_Mm01_00068217 predicted 544
7 SASI_Mm01_00068218 predicted 566
8 SASI_Mm01_00068219 predicted 985
9 SASI_Mm01_00068220 predicted 476
10 SASI_Mm01_00068221 predicted 936
11 SASI_Mm01_00068222 predicted 868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012242
VALIDATED
DKK1 MISSION shRNA Bacterial Glycerol Stock
dickkopf WNT signaling pathway inhibitor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012242.1-899s1c1
Sequence:CCGGGCCAGTAATTCTTCTAGGCTTCTCGAGAAGCCTAGAAGAATTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012242.1-773s1c1
Sequence:CCGGCCTGTCCTGAAAGAAGGTCAACTCGAGTTGACCTTCTTTCAGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012242.1-645s1c1
Sequence:CCGGCCAGAAGAACCACCTTGTCTTCTCGAGAAGACAAGGTGGTTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012242.1-349s1c1
Sequence:CCGGCGGGAATAAGTACCAGACCATCTCGAGATGGTCTGGTACTTATTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012242.1-243s1c1
Sequence:CCGGCGGTTCTCAATTCCAACGCTACTCGAGTAGCGTTGGAATTGAGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_012242.2-660s21c1
Sequence:CCGGCCAGAAGAACCACCTTGTCTTCTCGAGAAGACAAGGTGGTTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012242.2-258s21c1
Sequence:CCGGCGGTTCTCAATTCCAACGCTACTCGAGTAGCGTTGGAATTGAGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_012242.2-788s21c1
Sequence:CCGGCCTGTCCTGAAAGAAGGTCAACTCGAGTTGACCTTCTTTCAGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012242.2-936s21c1
Sequence:CCGGACACTTGTCAGAGACACTAAACTCGAGTTTAGTGTCTCTGACAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012242.2-1272s21c1
Sequence:CCGGTGTTATCTTGACTGACAAATACTCGAGTATTTGTCAGTCAAGATAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012242
VALIDATED
DKK1 MISSION shRNA shRNA Plasmid DNA
dickkopf WNT signaling pathway inhibitor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012242.1-899s1c1
Sequence:CCGGGCCAGTAATTCTTCTAGGCTTCTCGAGAAGCCTAGAAGAATTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012242.1-773s1c1
Sequence:CCGGCCTGTCCTGAAAGAAGGTCAACTCGAGTTGACCTTCTTTCAGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012242.1-645s1c1
Sequence:CCGGCCAGAAGAACCACCTTGTCTTCTCGAGAAGACAAGGTGGTTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012242.1-349s1c1
Sequence:CCGGCGGGAATAAGTACCAGACCATCTCGAGATGGTCTGGTACTTATTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012242.1-243s1c1
Sequence:CCGGCGGTTCTCAATTCCAACGCTACTCGAGTAGCGTTGGAATTGAGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_012242.2-660s21c1
Sequence:CCGGCCAGAAGAACCACCTTGTCTTCTCGAGAAGACAAGGTGGTTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012242.2-258s21c1
Sequence:CCGGCGGTTCTCAATTCCAACGCTACTCGAGTAGCGTTGGAATTGAGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_012242.2-788s21c1
Sequence:CCGGCCTGTCCTGAAAGAAGGTCAACTCGAGTTGACCTTCTTTCAGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012242.2-936s21c1
Sequence:CCGGACACTTGTCAGAGACACTAAACTCGAGTTTAGTGTCTCTGACAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012242.2-1272s21c1
Sequence:CCGGTGTTATCTTGACTGACAAATACTCGAGTATTTGTCAGTCAAGATAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012242
VALIDATED
DKK1 MISSION shRNA Lentiviral Transduction Particles
dickkopf WNT signaling pathway inhibitor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012242.1-899s1c1
Sequence:CCGGGCCAGTAATTCTTCTAGGCTTCTCGAGAAGCCTAGAAGAATTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012242.1-773s1c1
Sequence:CCGGCCTGTCCTGAAAGAAGGTCAACTCGAGTTGACCTTCTTTCAGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012242.1-645s1c1
Sequence:CCGGCCAGAAGAACCACCTTGTCTTCTCGAGAAGACAAGGTGGTTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012242.1-349s1c1
Sequence:CCGGCGGGAATAAGTACCAGACCATCTCGAGATGGTCTGGTACTTATTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012242.1-243s1c1
Sequence:CCGGCGGTTCTCAATTCCAACGCTACTCGAGTAGCGTTGGAATTGAGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_012242.2-660s21c1
Sequence:CCGGCCAGAAGAACCACCTTGTCTTCTCGAGAAGACAAGGTGGTTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012242.2-258s21c1
Sequence:CCGGCGGTTCTCAATTCCAACGCTACTCGAGTAGCGTTGGAATTGAGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_012242.2-788s21c1
Sequence:CCGGCCTGTCCTGAAAGAAGGTCAACTCGAGTTGACCTTCTTTCAGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012242.2-936s21c1
Sequence:CCGGACACTTGTCAGAGACACTAAACTCGAGTTTAGTGTCTCTGACAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012242.2-1272s21c1
Sequence:CCGGTGTTATCTTGACTGACAAATACTCGAGTATTTGTCAGTCAAGATAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010051
DKK1 MISSION shRNA Bacterial Glycerol Stock
dickkopf WNT signaling pathway inhibitor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010051.2-1119s1c1
Sequence:CCGGGCAGTAAATTACTGTGTTGTACTCGAGTACAACACAGTAATTTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010051.2-883s1c1
Sequence:CCGGGATCACCATCAAGCCAGCAATCTCGAGATTGCTGGCTTGATGGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010051.2-729s1c1
Sequence:CCGGGCTGTGTTGTGCAAGACACTTCTCGAGAAGTGTCTTGCACAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010051.2-157s1c1
Sequence:CCGGGCCGTGTTTACAATGATGGCTCTCGAGAGCCATCATTGTAAACACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010051.2-228s1c1
Sequence:CCGGCATCAATTCCAACGCGATCAACTCGAGTTGATCGCGTTGGAATTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010051.3-829s21c1
Sequence:CCGGGAGATATTCCAGCGCTGTTACCTCGAGGTAACAGCGCTGGAATATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010051.3-918s21c1
Sequence:CCGGCACCTGCCAGAGACACTAAACCTCGAGGTTTAGTGTCTCTGGCAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010051.3-1366s21c1
Sequence:CCGGAGTCGGTGATAGGCATCTAAACTCGAGTTTAGATGCCTATCACCGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010051.3-1249s21c1
Sequence:CCGGGTTGATTGTCTTGACTCATAACTCGAGTTATGAGTCAAGACAATCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010051.3-1040s21c1
Sequence:CCGGTAATTAAGCATTCCGACAATACTCGAGTATTGTCGGAATGCTTAATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010051
DKK1 MISSION shRNA shRNA Plasmid DNA
dickkopf WNT signaling pathway inhibitor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010051.2-1119s1c1
Sequence:CCGGGCAGTAAATTACTGTGTTGTACTCGAGTACAACACAGTAATTTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010051.2-883s1c1
Sequence:CCGGGATCACCATCAAGCCAGCAATCTCGAGATTGCTGGCTTGATGGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010051.2-729s1c1
Sequence:CCGGGCTGTGTTGTGCAAGACACTTCTCGAGAAGTGTCTTGCACAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010051.2-157s1c1
Sequence:CCGGGCCGTGTTTACAATGATGGCTCTCGAGAGCCATCATTGTAAACACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010051.2-228s1c1
Sequence:CCGGCATCAATTCCAACGCGATCAACTCGAGTTGATCGCGTTGGAATTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010051.3-829s21c1
Sequence:CCGGGAGATATTCCAGCGCTGTTACCTCGAGGTAACAGCGCTGGAATATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010051.3-918s21c1
Sequence:CCGGCACCTGCCAGAGACACTAAACCTCGAGGTTTAGTGTCTCTGGCAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010051.3-1366s21c1
Sequence:CCGGAGTCGGTGATAGGCATCTAAACTCGAGTTTAGATGCCTATCACCGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010051.3-1249s21c1
Sequence:CCGGGTTGATTGTCTTGACTCATAACTCGAGTTATGAGTCAAGACAATCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010051.3-1040s21c1
Sequence:CCGGTAATTAAGCATTCCGACAATACTCGAGTATTGTCGGAATGCTTAATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010051
DKK1 MISSION shRNA Lentiviral Transduction Particles
dickkopf WNT signaling pathway inhibitor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010051.2-1119s1c1
Sequence:CCGGGCAGTAAATTACTGTGTTGTACTCGAGTACAACACAGTAATTTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010051.2-883s1c1
Sequence:CCGGGATCACCATCAAGCCAGCAATCTCGAGATTGCTGGCTTGATGGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010051.2-729s1c1
Sequence:CCGGGCTGTGTTGTGCAAGACACTTCTCGAGAAGTGTCTTGCACAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010051.2-157s1c1
Sequence:CCGGGCCGTGTTTACAATGATGGCTCTCGAGAGCCATCATTGTAAACACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010051.2-228s1c1
Sequence:CCGGCATCAATTCCAACGCGATCAACTCGAGTTGATCGCGTTGGAATTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010051.3-829s21c1
Sequence:CCGGGAGATATTCCAGCGCTGTTACCTCGAGGTAACAGCGCTGGAATATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010051.3-918s21c1
Sequence:CCGGCACCTGCCAGAGACACTAAACCTCGAGGTTTAGTGTCTCTGGCAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010051.3-1366s21c1
Sequence:CCGGAGTCGGTGATAGGCATCTAAACTCGAGTTTAGATGCCTATCACCGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010051.3-1249s21c1
Sequence:CCGGGTTGATTGTCTTGACTCATAACTCGAGTTATGAGTCAAGACAATCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010051.3-1040s21c1
Sequence:CCGGTAATTAAGCATTCCGACAATACTCGAGTATTGTCGGAATGCTTAATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)