EMAIL THIS PAGE TO A FRIEND

DKK2

dickkopf WNT signaling pathway inhibitor 2

119 Gene Product Result for
Synonyms: DKK-2
UniProtKB ID: Q9UBU2, A0AVE9, B2R6S7, Q9UIU3
Gene ID:
Human(27123) Summary: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. It can act as either an agonist or antagonist of Wnt/beta-catenin signaling, depending on the cellular context and the presence of the co-factor kremen 2. Activity of this protein is also modulated by binding to the Wnt co-receptor LDL-receptor related protein 6 (LRP6). [provided by RefSeq, Jul 2008]
Mouse(56811) dickkopf homolog 2 (Xenopus laevis)
Rat(295445) dickkopf WNT signaling pathway inhibitor 2
Zebrafish(792404) dickkopf homolog 2 (Xenopus laevis)
domestic cat(101090100) dickkopf 2 homolog (Xenopus laevis)
dog(478502) dickkopf 2 homolog (Xenopus laevis)
cow(541161) dickkopf homolog 2 (Xenopus laevis)
chicken(422531) dickkopf 2 homolog (Xenopus laevis)
naked mole-rat(101716025) dickkopf WNT signaling pathway inhibitor 2
domestic guinea pig(100715224) dickkopf WNT signaling pathway inhibitor 2
sheep(101123633) dickkopf 2 homolog (Xenopus laevis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014421 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020265 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020265 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020265 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051371 MISSION® esiRNA esiRNA human DKK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014421 Rosetta Predictions human pricing
NM_001106472 Rosetta Predictions rat pricing
NM_020265 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024889 predicted 708
2 SASI_Hs01_00024890 predicted 1486
3 SASI_Hs01_00024891 predicted 1481
4 SASI_Hs01_00024892 predicted 1334
5 SASI_Hs01_00024893 predicted 1484
6 SASI_Hs01_00024894 predicted 1065
7 SASI_Hs01_00024895 predicted 1174
8 SASI_Hs01_00024896 predicted 952
9 SASI_Hs01_00024897 predicted 1209
10 SASI_Hs02_00345619 predicted 1248
11 SASI_Hs01_00024898 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106472 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219298 predicted 1467
2 SASI_Rn02_00219299 predicted 1101
3 SASI_Rn02_00219300 predicted 1567
4 SASI_Rn02_00219301 predicted 1195
5 SASI_Rn02_00219302 predicted 992
6 SASI_Rn02_00219303 predicted 1535
7 SASI_Rn02_00219304 predicted 821
8 SASI_Rn02_00219305 predicted 1560
9 SASI_Rn02_00219306 predicted 1259
10 SASI_Rn02_00219307 predicted 1702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020265 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030020 predicted 1687
2 SASI_Mm01_00030021 predicted 968
3 SASI_Mm01_00030022 predicted 978
4 SASI_Mm01_00030023 predicted 1759
5 SASI_Mm01_00030024 predicted 1183
6 SASI_Mm01_00030025 predicted 1049
7 SASI_Mm01_00030027 predicted 968
8 SASI_Mm01_00030028 predicted 1238
9 SASI_Mm02_00325451 predicted 1094
10 SASI_Mm02_00325452 predicted 1670
11 SASI_Mm01_00030026 predicted 1705
12 SASI_Mm01_00030029 predicted 1168
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014421
DKK2 MISSION shRNA Bacterial Glycerol Stock
dickkopf WNT signaling pathway inhibitor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014421.2-1149s21c1
Sequence:CCGGAGATCGAAACCACGGTCATTACTCGAGTAATGACCGTGGTTTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014421.2-1873s21c1
Sequence:CCGGTCTATTCAACGTTAGAGTTTACTCGAGTAAACTCTAACGTTGAATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014421.2-1212s21c1
Sequence:CCGGCACTAAGATGTCACATATAAACTCGAGTTTATATGTGACATCTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-1079s1c1
Sequence:CCGGGCTGCAATAATGGCATCTGTACTCGAGTACAGATGCCATTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-964s1c1
Sequence:CCGGGAGTGTGAAGTTGGGAGGTATCTCGAGATACCTCCCAACTTCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-941s1c1
Sequence:CCGGCCTACCCTTGTAGCAGTGATACTCGAGTATCACTGCTACAAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-1366s1c1
Sequence:CCGGCAACGCAAGAAGGGTTCTCATCTCGAGATGAGAACCCTTCTTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-1266s1c1
Sequence:CCGGCCTACGATCATCAGACTGCATCTCGAGATGCAGTCTGATGATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014421
DKK2 MISSION shRNA shRNA Plasmid DNA
dickkopf WNT signaling pathway inhibitor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014421.2-1149s21c1
Sequence:CCGGAGATCGAAACCACGGTCATTACTCGAGTAATGACCGTGGTTTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014421.2-1873s21c1
Sequence:CCGGTCTATTCAACGTTAGAGTTTACTCGAGTAAACTCTAACGTTGAATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014421.2-1212s21c1
Sequence:CCGGCACTAAGATGTCACATATAAACTCGAGTTTATATGTGACATCTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-1079s1c1
Sequence:CCGGGCTGCAATAATGGCATCTGTACTCGAGTACAGATGCCATTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-964s1c1
Sequence:CCGGGAGTGTGAAGTTGGGAGGTATCTCGAGATACCTCCCAACTTCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-941s1c1
Sequence:CCGGCCTACCCTTGTAGCAGTGATACTCGAGTATCACTGCTACAAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-1366s1c1
Sequence:CCGGCAACGCAAGAAGGGTTCTCATCTCGAGATGAGAACCCTTCTTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-1266s1c1
Sequence:CCGGCCTACGATCATCAGACTGCATCTCGAGATGCAGTCTGATGATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014421
DKK2 MISSION shRNA Lentiviral Transduction Particles
dickkopf WNT signaling pathway inhibitor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014421.2-1149s21c1
Sequence:CCGGAGATCGAAACCACGGTCATTACTCGAGTAATGACCGTGGTTTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014421.2-1873s21c1
Sequence:CCGGTCTATTCAACGTTAGAGTTTACTCGAGTAAACTCTAACGTTGAATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014421.2-1212s21c1
Sequence:CCGGCACTAAGATGTCACATATAAACTCGAGTTTATATGTGACATCTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-1079s1c1
Sequence:CCGGGCTGCAATAATGGCATCTGTACTCGAGTACAGATGCCATTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-964s1c1
Sequence:CCGGGAGTGTGAAGTTGGGAGGTATCTCGAGATACCTCCCAACTTCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-941s1c1
Sequence:CCGGCCTACCCTTGTAGCAGTGATACTCGAGTATCACTGCTACAAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-1366s1c1
Sequence:CCGGCAACGCAAGAAGGGTTCTCATCTCGAGATGAGAACCCTTCTTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014421.1-1266s1c1
Sequence:CCGGCCTACGATCATCAGACTGCATCTCGAGATGCAGTCTGATGATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020265
VALIDATED
DKK2 MISSION shRNA Bacterial Glycerol Stock
dickkopf WNT signaling pathway inhibitor 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020265.4-966s21c1
Sequence:CCGGCTACCCTTGCAGCAGTGATAACTCGAGTTATCACTGCTGCAAGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020265.4-1247s21c1
Sequence:CCGGACTCCAAGATGCCTCATATAACTCGAGTTATATGAGGCATCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020265.4-1188s21c1
Sequence:CCGGTCGCAACCATGGTCACTATTCCTCGAGGAATAGTGACCATGGTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020265.4-1879s21c1
Sequence:CCGGTCTACTCAAAGCTACAGTTTACTCGAGTAAACTGTAGCTTTGAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020265.4-1214s21c1
Sequence:CCGGATGACCTGGGATGGCAGAATCCTCGAGGATTCTGCCATCCCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020265.2-2187s1c1
Sequence:CCGGGCCACTCATTTCTATTTCAAACTCGAGTTTGAAATAGAAATGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020265.2-1295s1c1
Sequence:CCGGCGGTCATCAGACTGCATTGATCTCGAGATCAATGCAGTCTGATGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020265.2-1247s1c1
Sequence:CCGGCACTCCAAGATGCCTCATATACTCGAGTATATGAGGCATCTTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020265.2-1104s1c1
Sequence:CCGGGCTGCAATAATGGAATCTGCACTCGAGTGCAGATTCCATTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020265.2-972s1c1
Sequence:CCGGCTTGCAGCAGTGATAAGGAATCTCGAGATTCCTTATCACTGCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020265
VALIDATED
DKK2 MISSION shRNA shRNA Plasmid DNA
dickkopf WNT signaling pathway inhibitor 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020265.4-966s21c1
Sequence:CCGGCTACCCTTGCAGCAGTGATAACTCGAGTTATCACTGCTGCAAGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020265.4-1247s21c1
Sequence:CCGGACTCCAAGATGCCTCATATAACTCGAGTTATATGAGGCATCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020265.4-1188s21c1
Sequence:CCGGTCGCAACCATGGTCACTATTCCTCGAGGAATAGTGACCATGGTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020265.4-1879s21c1
Sequence:CCGGTCTACTCAAAGCTACAGTTTACTCGAGTAAACTGTAGCTTTGAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020265.4-1214s21c1
Sequence:CCGGATGACCTGGGATGGCAGAATCCTCGAGGATTCTGCCATCCCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020265.2-2187s1c1
Sequence:CCGGGCCACTCATTTCTATTTCAAACTCGAGTTTGAAATAGAAATGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020265.2-1295s1c1
Sequence:CCGGCGGTCATCAGACTGCATTGATCTCGAGATCAATGCAGTCTGATGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020265.2-1247s1c1
Sequence:CCGGCACTCCAAGATGCCTCATATACTCGAGTATATGAGGCATCTTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020265.2-1104s1c1
Sequence:CCGGGCTGCAATAATGGAATCTGCACTCGAGTGCAGATTCCATTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020265.2-972s1c1
Sequence:CCGGCTTGCAGCAGTGATAAGGAATCTCGAGATTCCTTATCACTGCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020265
VALIDATED
DKK2 MISSION shRNA Lentiviral Transduction Particles
dickkopf WNT signaling pathway inhibitor 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020265.4-966s21c1
Sequence:CCGGCTACCCTTGCAGCAGTGATAACTCGAGTTATCACTGCTGCAAGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020265.4-1247s21c1
Sequence:CCGGACTCCAAGATGCCTCATATAACTCGAGTTATATGAGGCATCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020265.4-1188s21c1
Sequence:CCGGTCGCAACCATGGTCACTATTCCTCGAGGAATAGTGACCATGGTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020265.4-1879s21c1
Sequence:CCGGTCTACTCAAAGCTACAGTTTACTCGAGTAAACTGTAGCTTTGAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020265.4-1214s21c1
Sequence:CCGGATGACCTGGGATGGCAGAATCCTCGAGGATTCTGCCATCCCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020265.2-2187s1c1
Sequence:CCGGGCCACTCATTTCTATTTCAAACTCGAGTTTGAAATAGAAATGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020265.2-1295s1c1
Sequence:CCGGCGGTCATCAGACTGCATTGATCTCGAGATCAATGCAGTCTGATGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020265.2-1247s1c1
Sequence:CCGGCACTCCAAGATGCCTCATATACTCGAGTATATGAGGCATCTTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020265.2-1104s1c1
Sequence:CCGGGCTGCAATAATGGAATCTGCACTCGAGTGCAGATTCCATTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020265.2-972s1c1
Sequence:CCGGCTTGCAGCAGTGATAAGGAATCTCGAGATTCCTTATCACTGCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks