EMAIL THIS PAGE TO A FRIEND

DKK3

dickkopf WNT signaling pathway inhibitor 3

209 Gene Product Result for
Synonyms: REIC RIG
UniProtKB ID: Q9UBP4, A8K1I2, D3DQW1, Q9ULB7
Gene ID:
Human(27122) Summary: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. The expression of this gene is decreased in a variety of cancer cell lines and it may function as a tumor suppressor gene. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(50781) dickkopf homolog 3 (Xenopus laevis)
Rat(171548) dickkopf WNT signaling pathway inhibitor 3
sheep(101122131) dickkopf 3 homolog (Xenopus laevis)
domestic guinea pig(100734886) dickkopf WNT signaling pathway inhibitor 3
naked mole-rat(101712164) dickkopf WNT signaling pathway inhibitor 3
Zebrafish(100038765) dickkopf homolog 3 (Xenopus laevis)
cow(506627) dickkopf homolog 3 (Xenopus laevis)
domestic cat(101093392) dickkopf 3 homolog (Xenopus laevis)
dog(476857) dickkopf 3 homolog (Xenopus laevis)
chicken(396023) dickkopf homolog 3 (Xenopus laevis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015881 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015881 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015881 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018057 Rosetta Predictions human pricing
NM_013253 Rosetta Predictions human pricing
NM_015881 Rosetta Predictions human pricing
NM_138519 Rosetta Predictions rat pricing
XM_579647 Rosetta Predictions rat pricing
NM_015814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306945 predicted 1389
2 SASI_Hs01_00175794 predicted 374
3 SASI_Hs01_00175796 predicted 896
4 SASI_Hs01_00175797 predicted 1200
5 SASI_Hs02_00306946 predicted 532
6 SASI_Hs01_00175798 predicted 1186
7 SASI_Hs01_00175799 predicted 452
8 SASI_Hs01_00175801 predicted 289
9 SASI_Hs01_00175802 predicted 506
10 SASI_Hs01_00175803 predicted 411
11 SASI_Hs01_00175795 predicted 666
12 SASI_Hs01_00175800 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344466 predicted 1556
2 SASI_Hs01_00034039 predicted 539
3 SASI_Hs01_00034041 predicted 1061
4 SASI_Hs01_00034042 predicted 1369
5 SASI_Hs02_00344467 predicted 696
6 SASI_Hs01_00034043 predicted 1349
7 SASI_Hs01_00034044 predicted 614
8 SASI_Hs01_00034046 predicted 450
9 SASI_Hs01_00034047 predicted 672
10 SASI_Hs01_00034048 predicted 588
11 SASI_Hs01_00034040 predicted 828
12 SASI_Hs01_00034045 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348464 predicted 1572
2 SASI_Hs01_00223813 predicted 553
3 SASI_Hs01_00223815 predicted 1071
4 SASI_Hs01_00223816 predicted 1382
5 SASI_Hs02_00348465 predicted 709
6 SASI_Hs01_00223817 predicted 1364
7 SASI_Hs01_00223818 predicted 632
8 SASI_Hs01_00223820 predicted 466
9 SASI_Hs01_00223821 predicted 692
10 SASI_Hs01_00223822 predicted 599
11 SASI_Hs01_00223814 predicted 845
12 SASI_Hs01_00223819 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138519 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106217 predicted 1057
2 SASI_Rn01_00106218 predicted 428
3 SASI_Rn01_00106219 predicted 221
4 SASI_Rn01_00106222 predicted 1176
5 SASI_Rn01_00106223 predicted 1080
6 SASI_Rn01_00106224 predicted 1401
7 SASI_Rn01_00106225 predicted 1076
8 SASI_Rn01_00106226 predicted 827
9 SASI_Rn02_00268134 predicted 427
10 SASI_Rn02_00268135 predicted 1347
11 SASI_Rn01_00106220 predicted 616
12 SASI_Rn01_00106221 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156118 predicted 430
2 SASI_Rn01_00156119 predicted 609
3 SASI_Rn01_00156120 predicted 273
4 SASI_Rn01_00156121 predicted 739
5 SASI_Rn01_00156122 predicted 835
6 SASI_Rn01_00156123 predicted 431
7 SASI_Rn01_00156124 predicted 331
8 SASI_Rn01_00156125 predicted 644
9 SASI_Rn01_00156126 predicted 365
10 SASI_Rn01_00156127 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153749 predicted 1351
2 SASI_Mm01_00153750 predicted 1285
3 SASI_Mm01_00153751 predicted 537
4 SASI_Mm01_00153752 predicted 1194
5 SASI_Mm01_00153753 predicted 1446
6 SASI_Mm01_00153754 predicted 717
7 SASI_Mm02_00323204 predicted 1181
8 SASI_Mm01_00153755 predicted 1501
9 SASI_Mm01_00153756 predicted 382
10 SASI_Mm01_00153757 predicted 473
11 SASI_Mm01_00153758 predicted 334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015814
VALIDATED
DKK3 MISSION shRNA Bacterial Glycerol Stock
dickkopf WNT signaling pathway inhibitor 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015814.2-248s1c1
Sequence:CCGGGCTACGCTCAATGAGATGTTTCTCGAGAAACATCTCATTGAGCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015814.2-1028s1c1
Sequence:CCGGCCGGATGAGTACGAAGATGTTCTCGAGAACATCTTCGTACTCATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015814.2-377s1c1
Sequence:CCGGGCAAGCTTACCTCCCAACTATCTCGAGATAGTTGGGAGGTAAGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015814.2-735s1c1
Sequence:CCGGTCTGTGACAACCAGAGGGATTCTCGAGAATCCCTCTGGTTGTCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015814.2-545s1c1
Sequence:CCGGAGCCATGAATGTATCATTGATCTCGAGATCAATGATACATTCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015814.2-377s21c1
Sequence:CCGGGCAAGCTTACCTCCCAACTATCTCGAGATAGTTGGGAGGTAAGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015814.2-1028s21c1
Sequence:CCGGCCGGATGAGTACGAAGATGTTCTCGAGAACATCTTCGTACTCATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015814.2-248s21c1
Sequence:CCGGGCTACGCTCAATGAGATGTTTCTCGAGAAACATCTCATTGAGCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015814.2-735s21c1
Sequence:CCGGTCTGTGACAACCAGAGGGATTCTCGAGAATCCCTCTGGTTGTCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015814
VALIDATED
DKK3 MISSION shRNA shRNA Plasmid DNA
dickkopf WNT signaling pathway inhibitor 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015814.2-248s1c1
Sequence:CCGGGCTACGCTCAATGAGATGTTTCTCGAGAAACATCTCATTGAGCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015814.2-1028s1c1
Sequence:CCGGCCGGATGAGTACGAAGATGTTCTCGAGAACATCTTCGTACTCATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015814.2-377s1c1
Sequence:CCGGGCAAGCTTACCTCCCAACTATCTCGAGATAGTTGGGAGGTAAGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015814.2-735s1c1
Sequence:CCGGTCTGTGACAACCAGAGGGATTCTCGAGAATCCCTCTGGTTGTCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015814.2-545s1c1
Sequence:CCGGAGCCATGAATGTATCATTGATCTCGAGATCAATGATACATTCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015814.2-377s21c1
Sequence:CCGGGCAAGCTTACCTCCCAACTATCTCGAGATAGTTGGGAGGTAAGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015814.2-1028s21c1
Sequence:CCGGCCGGATGAGTACGAAGATGTTCTCGAGAACATCTTCGTACTCATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015814.2-248s21c1
Sequence:CCGGGCTACGCTCAATGAGATGTTTCTCGAGAAACATCTCATTGAGCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015814.2-735s21c1
Sequence:CCGGTCTGTGACAACCAGAGGGATTCTCGAGAATCCCTCTGGTTGTCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015814
VALIDATED
DKK3 MISSION shRNA Lentiviral Transduction Particles
dickkopf WNT signaling pathway inhibitor 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015814.2-248s1c1
Sequence:CCGGGCTACGCTCAATGAGATGTTTCTCGAGAAACATCTCATTGAGCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015814.2-1028s1c1
Sequence:CCGGCCGGATGAGTACGAAGATGTTCTCGAGAACATCTTCGTACTCATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015814.2-377s1c1
Sequence:CCGGGCAAGCTTACCTCCCAACTATCTCGAGATAGTTGGGAGGTAAGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015814.2-735s1c1
Sequence:CCGGTCTGTGACAACCAGAGGGATTCTCGAGAATCCCTCTGGTTGTCACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015814.2-545s1c1
Sequence:CCGGAGCCATGAATGTATCATTGATCTCGAGATCAATGATACATTCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015814.2-377s21c1
Sequence:CCGGGCAAGCTTACCTCCCAACTATCTCGAGATAGTTGGGAGGTAAGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015814.2-1028s21c1
Sequence:CCGGCCGGATGAGTACGAAGATGTTCTCGAGAACATCTTCGTACTCATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015814.2-248s21c1
Sequence:CCGGGCTACGCTCAATGAGATGTTTCTCGAGAAACATCTCATTGAGCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015814.2-735s21c1
Sequence:CCGGTCTGTGACAACCAGAGGGATTCTCGAGAATCCCTCTGGTTGTCACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015881
DKK3 MISSION shRNA Bacterial Glycerol Stock
dickkopf WNT signaling pathway inhibitor 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-572s1c1
Sequence:CCGGGCACCGAGAAATTCACAAGATCTCGAGATCTTGTGAATTTCTCGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-702s1c1
Sequence:CCGGCCCAGCATGTACTGCCAGTTTCTCGAGAAACTGGCAGTACATGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-540s1c1
Sequence:CCGGGACACGAAGGTTGGAAATAATCTCGAGATTATTTCCAACCTTCGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-471s1c1
Sequence:CCGGGCTGCTAAAGCATCATCAGAACTCGAGTTCTGATGATGCTTTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-501s1c1
Sequence:CCGGGCAAACTTACCTCCCAGCTATCTCGAGATAGCTGGGAGGTAAGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015881
DKK3 MISSION shRNA shRNA Plasmid DNA
dickkopf WNT signaling pathway inhibitor 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-572s1c1
Sequence:CCGGGCACCGAGAAATTCACAAGATCTCGAGATCTTGTGAATTTCTCGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-702s1c1
Sequence:CCGGCCCAGCATGTACTGCCAGTTTCTCGAGAAACTGGCAGTACATGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-540s1c1
Sequence:CCGGGACACGAAGGTTGGAAATAATCTCGAGATTATTTCCAACCTTCGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-471s1c1
Sequence:CCGGGCTGCTAAAGCATCATCAGAACTCGAGTTCTGATGATGCTTTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-501s1c1
Sequence:CCGGGCAAACTTACCTCCCAGCTATCTCGAGATAGCTGGGAGGTAAGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015881
DKK3 MISSION shRNA Lentiviral Transduction Particles
dickkopf WNT signaling pathway inhibitor 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-572s1c1
Sequence:CCGGGCACCGAGAAATTCACAAGATCTCGAGATCTTGTGAATTTCTCGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-702s1c1
Sequence:CCGGCCCAGCATGTACTGCCAGTTTCTCGAGAAACTGGCAGTACATGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-540s1c1
Sequence:CCGGGACACGAAGGTTGGAAATAATCTCGAGATTATTTCCAACCTTCGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-471s1c1
Sequence:CCGGGCTGCTAAAGCATCATCAGAACTCGAGTTCTGATGATGCTTTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015881.4-501s1c1
Sequence:CCGGGCAAACTTACCTCCCAGCTATCTCGAGATAGCTGGGAGGTAAGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)