EMAIL THIS PAGE TO A FRIEND

DKK4

dickkopf WNT signaling pathway inhibitor 4

59 Gene Product Result for
Synonyms: DKK-4
UniProtKB ID: Q9UBT3, Q3KNX0, Q9Y4C3
Gene ID:
Human(27121) Summary: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. Activity of this protein is modulated by binding to the Wnt co-receptor and the co-factor kremen 2. [provided by RefSeq, Jul 2008]
Mouse(234130) dickkopf homolog 4 (Xenopus laevis)
Rat(502097) dickkopf WNT signaling pathway inhibitor 4
domestic cat(101099547) dickkopf homolog 4 (Xenopus laevis)
cow(509338) dickkopf WNT signaling pathway inhibitor 4
dog(607210) dickkopf homolog 4 (Xenopus laevis)
naked mole-rat(101713511) dickkopf WNT signaling pathway inhibitor 4
sheep(101118586) dickkopf homolog 4 (Xenopus laevis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014420 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014420 Rosetta Predictions human pricing
NM_001109332 Rosetta Predictions rat pricing
XM_577537 Rosetta Predictions rat pricing
NM_145592 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069994 predicted 352
2 SASI_Hs01_00069995 predicted 234
3 SASI_Hs01_00069997 predicted 291
4 SASI_Hs01_00069998 predicted 359
5 SASI_Hs01_00069999 predicted 360
6 SASI_Hs01_00070000 predicted 284
7 SASI_Hs01_00070001 predicted 528
8 SASI_Hs01_00070002 predicted 232
9 SASI_Hs01_00070003 predicted 569
10 SASI_Hs02_00345618 predicted 524
11 SASI_Hs01_00069996 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247384 predicted 518
2 SASI_Rn02_00247385 predicted 1262
3 SASI_Rn02_00247386 predicted 1214
4 SASI_Rn02_00247387 predicted 1173
5 SASI_Rn02_00247388 predicted 1158
6 SASI_Rn02_00247389 predicted 294
7 SASI_Rn02_00247390 predicted 1139
8 SASI_Rn02_00247391 predicted 375
9 SASI_Rn02_00247392 predicted 526
10 SASI_Rn02_00247393 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194378 predicted 242
2 SASI_Rn01_00194379 predicted 387
3 SASI_Rn01_00194380 predicted 292
4 SASI_Rn01_00194381 predicted 289
5 SASI_Rn01_00194382 predicted 262
6 SASI_Rn01_00194383 predicted 389
7 SASI_Rn01_00194384 predicted 243
8 SASI_Rn01_00194385 predicted 394
9 SASI_Rn01_00194386 predicted 243
10 SASI_Rn01_00194387 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188549 predicted 582
2 SASI_Mm01_00188550 predicted 283
3 SASI_Mm01_00188551 predicted 288
4 SASI_Mm01_00188552 predicted 516
5 SASI_Mm02_00341129 predicted 633
6 SASI_Mm01_00188553 predicted 289
7 SASI_Mm01_00188554 predicted 556
8 SASI_Mm01_00188555 predicted 450
9 SASI_Mm01_00188556 predicted 380
10 SASI_Mm01_00188558 predicted 382
11 SASI_Mm01_00188557 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014420
DKK4 MISSION shRNA Bacterial Glycerol Stock
dickkopf WNT signaling pathway inhibitor 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-371s1c1
Sequence:CCGGGTGTGAACGATGTTTGTACTACTCGAGTAGTACAAACATCGTTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-677s1c1
Sequence:CCGGCTCCAGAAATCTTCCAGCGTTCTCGAGAACGCTGGAAGATTTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-249s1c1
Sequence:CCGGCACGGACTGCAATACCAGAAACTCGAGTTTCTGGTATTGCAGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-542s1c1
Sequence:CCGGGAGAAAGTTGTCTGAGAACTTCTCGAGAAGTTCTCAGACAACTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-443s1c1
Sequence:CCGGGCACACATGCAGAAGGAACAACTCGAGTTGTTCCTTCTGCATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-536s1c1
Sequence:CCGGGAGAAAGTTGTCTGAGAACTTCTCGAGAAGTTCTCAGACAACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-245s1c1
Sequence:CCGGCGGACTGCAATACCAGAAAGTCTCGAGACTTTCTGGTATTGCAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-662s1c1
Sequence:CCGGCTGCTCAAGCTCCAGAAATCTCTCGAGAGATTTCTGGAGCTTGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-376s1c1
Sequence:CCGGGTTTGTACTACGATGGAAGATCTCGAGATCTTCCATCGTAGTACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-369s1c1
Sequence:CCGGGAACGATGTTTGTACTACGATCTCGAGATCGTAGTACAAACATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014420
DKK4 MISSION shRNA shRNA Plasmid DNA
dickkopf WNT signaling pathway inhibitor 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-371s1c1
Sequence:CCGGGTGTGAACGATGTTTGTACTACTCGAGTAGTACAAACATCGTTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-677s1c1
Sequence:CCGGCTCCAGAAATCTTCCAGCGTTCTCGAGAACGCTGGAAGATTTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-249s1c1
Sequence:CCGGCACGGACTGCAATACCAGAAACTCGAGTTTCTGGTATTGCAGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-542s1c1
Sequence:CCGGGAGAAAGTTGTCTGAGAACTTCTCGAGAAGTTCTCAGACAACTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-443s1c1
Sequence:CCGGGCACACATGCAGAAGGAACAACTCGAGTTGTTCCTTCTGCATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-536s1c1
Sequence:CCGGGAGAAAGTTGTCTGAGAACTTCTCGAGAAGTTCTCAGACAACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-245s1c1
Sequence:CCGGCGGACTGCAATACCAGAAAGTCTCGAGACTTTCTGGTATTGCAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-662s1c1
Sequence:CCGGCTGCTCAAGCTCCAGAAATCTCTCGAGAGATTTCTGGAGCTTGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-376s1c1
Sequence:CCGGGTTTGTACTACGATGGAAGATCTCGAGATCTTCCATCGTAGTACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-369s1c1
Sequence:CCGGGAACGATGTTTGTACTACGATCTCGAGATCGTAGTACAAACATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014420
DKK4 MISSION shRNA Lentiviral Transduction Particles
dickkopf WNT signaling pathway inhibitor 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-371s1c1
Sequence:CCGGGTGTGAACGATGTTTGTACTACTCGAGTAGTACAAACATCGTTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-677s1c1
Sequence:CCGGCTCCAGAAATCTTCCAGCGTTCTCGAGAACGCTGGAAGATTTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-249s1c1
Sequence:CCGGCACGGACTGCAATACCAGAAACTCGAGTTTCTGGTATTGCAGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-542s1c1
Sequence:CCGGGAGAAAGTTGTCTGAGAACTTCTCGAGAAGTTCTCAGACAACTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014420.1-443s1c1
Sequence:CCGGGCACACATGCAGAAGGAACAACTCGAGTTGTTCCTTCTGCATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-536s1c1
Sequence:CCGGGAGAAAGTTGTCTGAGAACTTCTCGAGAAGTTCTCAGACAACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-245s1c1
Sequence:CCGGCGGACTGCAATACCAGAAAGTCTCGAGACTTTCTGGTATTGCAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-662s1c1
Sequence:CCGGCTGCTCAAGCTCCAGAAATCTCTCGAGAGATTTCTGGAGCTTGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-376s1c1
Sequence:CCGGGTTTGTACTACGATGGAAGATCTCGAGATCTTCCATCGTAGTACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014420.2-369s1c1
Sequence:CCGGGAACGATGTTTGTACTACGATCTCGAGATCGTAGTACAAACATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145592
DKK4 MISSION shRNA Bacterial Glycerol Stock
dickkopf WNT signaling pathway inhibitor 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-782s1c1
Sequence:CCGGGCTAAGAGTATGCCAAAGAATCTCGAGATTCTTTGGCATACTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-194s1c1
Sequence:CCGGCCTGGTTCTGGACTTTAACAACTCGAGTTGTTAAAGTCCAGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-525s1c1
Sequence:CCGGCCCAGTACGAAGAAATCACAACTCGAGTTGTGATTTCTTCGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-287s1c1
Sequence:CCGGAGGGAAATTCTGCTTAGCGTTCTCGAGAACGCTAAGCAGAATTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-760s1c1
Sequence:CCGGCCAGTAACAGACAACATTCAACTCGAGTTGAATGTTGTCTGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145592
DKK4 MISSION shRNA shRNA Plasmid DNA
dickkopf WNT signaling pathway inhibitor 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-782s1c1
Sequence:CCGGGCTAAGAGTATGCCAAAGAATCTCGAGATTCTTTGGCATACTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-194s1c1
Sequence:CCGGCCTGGTTCTGGACTTTAACAACTCGAGTTGTTAAAGTCCAGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-525s1c1
Sequence:CCGGCCCAGTACGAAGAAATCACAACTCGAGTTGTGATTTCTTCGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-287s1c1
Sequence:CCGGAGGGAAATTCTGCTTAGCGTTCTCGAGAACGCTAAGCAGAATTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-760s1c1
Sequence:CCGGCCAGTAACAGACAACATTCAACTCGAGTTGAATGTTGTCTGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145592
DKK4 MISSION shRNA Lentiviral Transduction Particles
dickkopf WNT signaling pathway inhibitor 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-782s1c1
Sequence:CCGGGCTAAGAGTATGCCAAAGAATCTCGAGATTCTTTGGCATACTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-194s1c1
Sequence:CCGGCCTGGTTCTGGACTTTAACAACTCGAGTTGTTAAAGTCCAGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-525s1c1
Sequence:CCGGCCCAGTACGAAGAAATCACAACTCGAGTTGTGATTTCTTCGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-287s1c1
Sequence:CCGGAGGGAAATTCTGCTTAGCGTTCTCGAGAACGCTAAGCAGAATTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145592.1-760s1c1
Sequence:CCGGCCAGTAACAGACAACATTCAACTCGAGTTGAATGTTGTCTGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks