EMAIL THIS PAGE TO A FRIEND

DKKL1

dickkopf-like 1

53 Gene Product Result for
Synonyms: CT34 SGY SGY-1 SGY1
UniProtKB ID: Q9UK85
Gene ID:
Human(27120) Summary: The dickkopf protein family interacts with the Wnt signaling pathway and its members are characterized by two conserved cysteine-rich domains. This gene encodes a secreted protein that has low sequence similarity to the dickkopf-3 protein. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Mouse(50722) dickkopf-like 1
Rat(499150) dickkopf-like 1
sheep(101105351) dickkopf-like 1
naked mole-rat(101706117) dickkopf-like 1
cow(540124) dickkopf-like 1
domestic cat(101098758) dickkopf-like 1
dog(610302) dickkopf-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1693 Human Soggy-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014419 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014419 Rosetta Predictions human pricing
NM_001109145 Rosetta Predictions rat pricing
NM_015789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144177 predicted 609
2 SASI_Hs01_00144178 predicted 571
3 SASI_Hs01_00144179 predicted 552
4 SASI_Hs01_00144180 predicted 309
5 SASI_Hs01_00144181 predicted 605
6 SASI_Hs01_00144182 predicted 555
7 SASI_Hs01_00144183 predicted 606
8 SASI_Hs01_00144185 predicted 538
9 SASI_Hs01_00144186 predicted 322
10 SASI_Hs02_00345617 predicted 456
11 SASI_Hs01_00144184 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245570 predicted 867
2 SASI_Rn02_00245571 predicted 735
3 SASI_Rn02_00245572 predicted 454
4 SASI_Rn02_00245573 predicted 888
5 SASI_Rn02_00245574 predicted 887
6 SASI_Rn02_00245575 predicted 480
7 SASI_Rn02_00245576 predicted 585
8 SASI_Rn02_00245577 predicted 782
9 SASI_Rn02_00245578 predicted 565
10 SASI_Rn02_00245579 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026345 predicted 494
2 SASI_Mm01_00026346 predicted 506
3 SASI_Mm01_00026347 predicted 230
4 SASI_Mm01_00026348 predicted 500
5 SASI_Mm01_00026349 predicted 333
6 SASI_Mm01_00026350 predicted 408
7 SASI_Mm01_00026351 predicted 455
8 SASI_Mm01_00026352 predicted 309
9 SASI_Mm01_00026353 predicted 251
10 SASI_Mm01_00026354 predicted 283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014419
DKKL1 MISSION shRNA Bacterial Glycerol Stock
dickkopf-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014419.3-716s1c1
Sequence:CCGGGCCTTCTGGATCATTAAGCTGCTCGAGCAGCTTAATGATCCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014419.3-463s1c1
Sequence:CCGGGAACTACCACAAAGAGGAGAACTCGAGTTCTCCTCTTTGTGGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-456s21c1
Sequence:CCGGTCCCTGGGAACTACCACAAAGCTCGAGCTTTGTGGTAGTTCCCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-712s21c1
Sequence:CCGGGGTGGCCTTCTGGATCATTAACTCGAGTTAATGATCCAGAAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-561s21c1
Sequence:CCGGAGGTGCTGATCTCCGAGAATGCTCGAGCATTCTCGGAGATCAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-412s21c1
Sequence:CCGGGGGCATAGACAGCTTATTCTCCTCGAGGAGAATAAGCTGTCTATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-531s21c1
Sequence:CCGGTCGACAAGATGACCGACAACACTCGAGTGTTGTCGGTCATCTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014419
DKKL1 MISSION shRNA shRNA Plasmid DNA
dickkopf-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014419.3-716s1c1
Sequence:CCGGGCCTTCTGGATCATTAAGCTGCTCGAGCAGCTTAATGATCCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014419.3-463s1c1
Sequence:CCGGGAACTACCACAAAGAGGAGAACTCGAGTTCTCCTCTTTGTGGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-456s21c1
Sequence:CCGGTCCCTGGGAACTACCACAAAGCTCGAGCTTTGTGGTAGTTCCCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-712s21c1
Sequence:CCGGGGTGGCCTTCTGGATCATTAACTCGAGTTAATGATCCAGAAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-561s21c1
Sequence:CCGGAGGTGCTGATCTCCGAGAATGCTCGAGCATTCTCGGAGATCAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-412s21c1
Sequence:CCGGGGGCATAGACAGCTTATTCTCCTCGAGGAGAATAAGCTGTCTATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-531s21c1
Sequence:CCGGTCGACAAGATGACCGACAACACTCGAGTGTTGTCGGTCATCTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014419
DKKL1 MISSION shRNA Lentiviral Transduction Particles
dickkopf-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014419.3-716s1c1
Sequence:CCGGGCCTTCTGGATCATTAAGCTGCTCGAGCAGCTTAATGATCCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014419.3-463s1c1
Sequence:CCGGGAACTACCACAAAGAGGAGAACTCGAGTTCTCCTCTTTGTGGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-456s21c1
Sequence:CCGGTCCCTGGGAACTACCACAAAGCTCGAGCTTTGTGGTAGTTCCCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-712s21c1
Sequence:CCGGGGTGGCCTTCTGGATCATTAACTCGAGTTAATGATCCAGAAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-561s21c1
Sequence:CCGGAGGTGCTGATCTCCGAGAATGCTCGAGCATTCTCGGAGATCAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-412s21c1
Sequence:CCGGGGGCATAGACAGCTTATTCTCCTCGAGGAGAATAAGCTGTCTATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014419.3-531s21c1
Sequence:CCGGTCGACAAGATGACCGACAACACTCGAGTGTTGTCGGTCATCTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015789
DKKL1 MISSION shRNA Bacterial Glycerol Stock
dickkopf-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-337s1c1
Sequence:CCGGCCTAGGAACTTCCATCAGGAACTCGAGTTCCTGATGGAAGTTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-396s1c1
Sequence:CCGGCAGCCACCTACAGATAGACAACTCGAGTTGTCTATCTGTAGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-244s1c1
Sequence:CCGGCTTCTCCAAAGCTTTAGTCGACTCGAGTCGACTAAAGCTTTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-408s1c1
Sequence:CCGGGATAGACAAGGTGACTGACAACTCGAGTTGTCAGTCACCTTGTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-342s1c1
Sequence:CCGGGAACTTCCATCAGGAAGAGAACTCGAGTTCTCTTCCTGATGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015789
DKKL1 MISSION shRNA shRNA Plasmid DNA
dickkopf-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-337s1c1
Sequence:CCGGCCTAGGAACTTCCATCAGGAACTCGAGTTCCTGATGGAAGTTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-396s1c1
Sequence:CCGGCAGCCACCTACAGATAGACAACTCGAGTTGTCTATCTGTAGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-244s1c1
Sequence:CCGGCTTCTCCAAAGCTTTAGTCGACTCGAGTCGACTAAAGCTTTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-408s1c1
Sequence:CCGGGATAGACAAGGTGACTGACAACTCGAGTTGTCAGTCACCTTGTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-342s1c1
Sequence:CCGGGAACTTCCATCAGGAAGAGAACTCGAGTTCTCTTCCTGATGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015789
DKKL1 MISSION shRNA Lentiviral Transduction Particles
dickkopf-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-337s1c1
Sequence:CCGGCCTAGGAACTTCCATCAGGAACTCGAGTTCCTGATGGAAGTTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-396s1c1
Sequence:CCGGCAGCCACCTACAGATAGACAACTCGAGTTGTCTATCTGTAGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-244s1c1
Sequence:CCGGCTTCTCCAAAGCTTTAGTCGACTCGAGTCGACTAAAGCTTTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-408s1c1
Sequence:CCGGGATAGACAAGGTGACTGACAACTCGAGTTGTCAGTCACCTTGTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015789.2-342s1c1
Sequence:CCGGGAACTTCCATCAGGAAGAGAACTCGAGTTCTCTTCCTGATGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks