EMAIL THIS PAGE TO A FRIEND

DLAT

dihydrolipoamide S-acetyltransferase

150 Gene Product Result for
Synonyms: DLTA PDC-E2 PDCE2
UniProtKB ID: P10515, Q16783, Q53EP3
Gene ID:
Human(1737) Summary: This gene encodes component E2 of the multi-enzyme pyruvate dehydrogenase complex (PDC). PDC resides in the inner mitochondrial membrane and catalyzes the conversion of pyruvate to acetyl coenzyme A. The protein product of this gene, dihydrolipoamide acetyltransferase, accepts acetyl groups formed by the oxidative decarboxylation of pyruvate and transfers them to coenzyme A. Dihydrolipoamide acetyltransferase is the antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC enventually leads to cirrhosis and liver failure. Mutations in this gene are also a cause of pyruvate dehydrogenase E2 deficiency which causes primary lactic acidosis in infancy and early childhood.[provided by RefSeq, Oct 2009]
Mouse(235339) dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex)
Rat(81654) dihydrolipoamide S-acetyltransferase
Zebrafish(324201) dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex)
domestic cat(101094126) dihydrolipoamide S-acetyltransferase
cow(512723) dihydrolipoamide S-acetyltransferase
Horse(100062027) dihydrolipoamide S-acetyltransferase
dog(489406) dihydrolipoamide S-acetyltransferase
chicken(419796) dihydrolipoamide S-acetyltransferase
naked mole-rat(101698667) dihydrolipoamide S-acetyltransferase
domestic guinea pig(100735563) dihydrolipoamide S-acetyltransferase
sheep(101110965) dihydrolipoamide S-acetyltransferase
Domestic Rabbit(100349212) dihydrolipoamide S-acetyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101077 Anti-DLAT (231-245) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1101078 Anti-DLAT (593-605) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
GW22844 Anti-DLAT antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
SAB1408946 Anti-DLAT antibody produced in mouse purified immunoglobulin, buffered aqueous solution rat, human
ELISA, immunofluorescence, western blot pricing
SAB2108113 Anti-DLAT antibody produced in rabbit affinity isolated antibody human, Caenorhabditis elegans, pig, rat, zebrafish, canine, mouse
western blot pricing
AV41994 Anti-DLAT antibody produced in rabbit IgG fraction of antiserum canine, horse, zebrafish, pig, rat, guinea pig, bovine, rabbit, human, mouse
immunohistochemistry, western blot pricing
HPA040786 Anti-DLAT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1410301 Anti-DLAT antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
HPA062766 Anti-DLAT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001931 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029881 MISSION® esiRNA esiRNA human DLAT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001931 Rosetta Predictions human pricing
NM_031025 Rosetta Predictions rat pricing
XM_001070811 Rosetta Predictions rat pricing
NM_145614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158464 predicted 1282
2 SASI_Hs01_00158466 predicted 1315
3 SASI_Hs01_00158467 predicted 1719
4 SASI_Hs01_00158468 predicted 1512
5 SASI_Hs01_00158471 predicted 1947
6 SASI_Hs02_00332828 predicted 1361
7 SASI_Hs02_00332829 predicted 1088
8 SASI_Hs01_00158473 predicted 1668
9 SASI_Hs02_00332830 predicted 1316
10 SASI_Hs02_00332831 predicted 1656
11 SASI_Hs01_00158465 predicted 1648
12 SASI_Hs01_00158469 predicted 1359
13 SASI_Hs01_00158470 predicted 1862
14 SASI_Hs01_00158472 predicted 1448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045392 predicted 1564
2 SASI_Rn01_00045394 predicted 1574
3 SASI_Rn01_00045395 predicted 1655
4 SASI_Rn01_00045396 predicted 1772
5 SASI_Rn02_00264224 predicted 841
6 SASI_Rn01_00045397 predicted 776
7 SASI_Rn01_00045398 predicted 1451
8 SASI_Rn02_00264225 predicted 896
9 SASI_Rn01_00045400 predicted 1651
10 SASI_Rn01_00045401 predicted 1239
11 SASI_Rn01_00045393 predicted 722
12 SASI_Rn01_00045399 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332920 predicted 1796
2 SASI_Rn02_00332921 predicted 1801
3 SASI_Rn02_00332922 predicted 1888
4 SASI_Rn02_00332923 predicted 2006
5 SASI_Rn02_00332924 predicted 1071
6 SASI_Rn02_00332925 predicted 1011
7 SASI_Rn02_00332926 predicted 1682
8 SASI_Rn02_00332927 predicted 1125
9 SASI_Rn02_00332928 predicted 1884
10 SASI_Rn02_00332929 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182660 predicted 1083
2 SASI_Mm01_00182661 predicted 1904
3 SASI_Mm01_00182662 predicted 1987
4 SASI_Mm02_00341189 predicted 1386
5 SASI_Mm01_00182663 predicted 2004
6 SASI_Mm01_00182664 predicted 2343
7 SASI_Mm01_00182665 predicted 1107
8 SASI_Mm02_00341190 predicted 1371
9 SASI_Mm01_00182666 predicted 1684
10 SASI_Mm01_00182667 predicted 1572
11 SASI_Mm01_00182668 predicted 2273
12 SASI_Mm01_00182669 predicted 1412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145614
VALIDATED
DLAT MISSION shRNA Bacterial Glycerol Stock
dihydrolipoamide S-acetyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-1775s21c1
Sequence:CCGGCGAAGCAAACTCGTCTTGGATCTCGAGATCCAAGACGAGTTTGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-579s21c1
Sequence:CCGGCCGCATCAGAAGGTTCCATTACTCGAGTAATGGAACCTTCTGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-1233s21c1
Sequence:CCGGCCAACAGAAGTGACCAGCTTACTCGAGTAAGCTGGTCACTTCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-747s21c1
Sequence:CCGGGCCAAGATCCTTGTTCCTGAACTCGAGTTCAGGAACAAGGATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-1906s21c1
Sequence:CCGGCCATTGCTAGTGATGTTGTTTCTCGAGAAACAACATCACTAGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-1907s1c1
Sequence:CCGGCCATTGCTAGTGATGTTGTTTCTCGAGAAACAACATCACTAGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-1234s1c1
Sequence:CCGGCCAACAGAAGTGACCAGCTTACTCGAGTAAGCTGGTCACTTCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-1776s1c1
Sequence:CCGGCGAAGCAAACTCGTCTTGGATCTCGAGATCCAAGACGAGTTTGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-748s1c1
Sequence:CCGGGCCAAGATCCTTGTTCCTGAACTCGAGTTCAGGAACAAGGATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-580s1c1
Sequence:CCGGCCGCATCAGAAGGTTCCATTACTCGAGTAATGGAACCTTCTGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145614
VALIDATED
DLAT MISSION shRNA shRNA Plasmid DNA
dihydrolipoamide S-acetyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-1775s21c1
Sequence:CCGGCGAAGCAAACTCGTCTTGGATCTCGAGATCCAAGACGAGTTTGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-579s21c1
Sequence:CCGGCCGCATCAGAAGGTTCCATTACTCGAGTAATGGAACCTTCTGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-1233s21c1
Sequence:CCGGCCAACAGAAGTGACCAGCTTACTCGAGTAAGCTGGTCACTTCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-747s21c1
Sequence:CCGGGCCAAGATCCTTGTTCCTGAACTCGAGTTCAGGAACAAGGATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-1906s21c1
Sequence:CCGGCCATTGCTAGTGATGTTGTTTCTCGAGAAACAACATCACTAGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-1907s1c1
Sequence:CCGGCCATTGCTAGTGATGTTGTTTCTCGAGAAACAACATCACTAGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-1234s1c1
Sequence:CCGGCCAACAGAAGTGACCAGCTTACTCGAGTAAGCTGGTCACTTCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-1776s1c1
Sequence:CCGGCGAAGCAAACTCGTCTTGGATCTCGAGATCCAAGACGAGTTTGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-748s1c1
Sequence:CCGGGCCAAGATCCTTGTTCCTGAACTCGAGTTCAGGAACAAGGATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-580s1c1
Sequence:CCGGCCGCATCAGAAGGTTCCATTACTCGAGTAATGGAACCTTCTGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145614
VALIDATED
DLAT MISSION shRNA Lentiviral Transduction Particles
dihydrolipoamide S-acetyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-1775s21c1
Sequence:CCGGCGAAGCAAACTCGTCTTGGATCTCGAGATCCAAGACGAGTTTGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-579s21c1
Sequence:CCGGCCGCATCAGAAGGTTCCATTACTCGAGTAATGGAACCTTCTGATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-1233s21c1
Sequence:CCGGCCAACAGAAGTGACCAGCTTACTCGAGTAAGCTGGTCACTTCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-747s21c1
Sequence:CCGGGCCAAGATCCTTGTTCCTGAACTCGAGTTCAGGAACAAGGATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145614.3-1906s21c1
Sequence:CCGGCCATTGCTAGTGATGTTGTTTCTCGAGAAACAACATCACTAGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-1907s1c1
Sequence:CCGGCCATTGCTAGTGATGTTGTTTCTCGAGAAACAACATCACTAGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-1234s1c1
Sequence:CCGGCCAACAGAAGTGACCAGCTTACTCGAGTAAGCTGGTCACTTCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-1776s1c1
Sequence:CCGGCGAAGCAAACTCGTCTTGGATCTCGAGATCCAAGACGAGTTTGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-748s1c1
Sequence:CCGGGCCAAGATCCTTGTTCCTGAACTCGAGTTCAGGAACAAGGATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145614.2-580s1c1
Sequence:CCGGCCGCATCAGAAGGTTCCATTACTCGAGTAATGGAACCTTCTGATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001931
VALIDATED
DLAT MISSION shRNA Bacterial Glycerol Stock
dihydrolipoamide S-acetyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001931.3-1949s21c1
Sequence:CCGGGGTTATTGCACAGCGATTAATCTCGAGATTAATCGCTGTGCAATAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001931.3-1984s21c1
Sequence:CCGGCCATACCTCATTATTACCTTTCTCGAGAAAGGTAATAATGAGGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001931.3-1035s21c1
Sequence:CCGGGCAGAGGTTGAAACTGATAAACTCGAGTTTATCAGTTTCAACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001931.3-1582s21c1
Sequence:CCGGCAACCGAAGTAACAGATTTAACTCGAGTTAAATCTGTTACTTCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001931.3-2717s21c1
Sequence:CCGGGAGTCTGTCCAGATAAGTTATCTCGAGATAACTTATCTGGACAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001931.2-1353s1c1
Sequence:CCGGCCATACCTCATTATTACCTTTCTCGAGAAAGGTAATAATGAGGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001931.2-1504s1c1
Sequence:CCGGCGAAGCAAATTCTTCTTGGATCTCGAGATCCAAGAAGAATTTGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001931.2-1925s1c1
Sequence:CCGGGCTGAGTTTAGAAAGTACCTTCTCGAGAAGGTACTTTCTAAACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001931.2-404s1c1
Sequence:CCGGGCAGAGGTTGAAACTGATAAACTCGAGTTTATCAGTTTCAACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001931.2-893s1c1
Sequence:CCGGCCACTCTGTATCATTGTAGAACTCGAGTTCTACAATGATACAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001931
VALIDATED
DLAT MISSION shRNA shRNA Plasmid DNA
dihydrolipoamide S-acetyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001931.3-1949s21c1
Sequence:CCGGGGTTATTGCACAGCGATTAATCTCGAGATTAATCGCTGTGCAATAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001931.3-1984s21c1
Sequence:CCGGCCATACCTCATTATTACCTTTCTCGAGAAAGGTAATAATGAGGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001931.3-1035s21c1
Sequence:CCGGGCAGAGGTTGAAACTGATAAACTCGAGTTTATCAGTTTCAACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001931.3-1582s21c1
Sequence:CCGGCAACCGAAGTAACAGATTTAACTCGAGTTAAATCTGTTACTTCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001931.3-2717s21c1
Sequence:CCGGGAGTCTGTCCAGATAAGTTATCTCGAGATAACTTATCTGGACAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001931.2-1353s1c1
Sequence:CCGGCCATACCTCATTATTACCTTTCTCGAGAAAGGTAATAATGAGGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001931.2-1504s1c1
Sequence:CCGGCGAAGCAAATTCTTCTTGGATCTCGAGATCCAAGAAGAATTTGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001931.2-1925s1c1
Sequence:CCGGGCTGAGTTTAGAAAGTACCTTCTCGAGAAGGTACTTTCTAAACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001931.2-404s1c1
Sequence:CCGGGCAGAGGTTGAAACTGATAAACTCGAGTTTATCAGTTTCAACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001931.2-893s1c1
Sequence:CCGGCCACTCTGTATCATTGTAGAACTCGAGTTCTACAATGATACAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001931
VALIDATED
DLAT MISSION shRNA Lentiviral Transduction Particles
dihydrolipoamide S-acetyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001931.3-1949s21c1
Sequence:CCGGGGTTATTGCACAGCGATTAATCTCGAGATTAATCGCTGTGCAATAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001931.3-1984s21c1
Sequence:CCGGCCATACCTCATTATTACCTTTCTCGAGAAAGGTAATAATGAGGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001931.3-1035s21c1
Sequence:CCGGGCAGAGGTTGAAACTGATAAACTCGAGTTTATCAGTTTCAACCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001931.3-1582s21c1
Sequence:CCGGCAACCGAAGTAACAGATTTAACTCGAGTTAAATCTGTTACTTCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001931.3-2717s21c1
Sequence:CCGGGAGTCTGTCCAGATAAGTTATCTCGAGATAACTTATCTGGACAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001931.2-1353s1c1
Sequence:CCGGCCATACCTCATTATTACCTTTCTCGAGAAAGGTAATAATGAGGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001931.2-1504s1c1
Sequence:CCGGCGAAGCAAATTCTTCTTGGATCTCGAGATCCAAGAAGAATTTGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001931.2-1925s1c1
Sequence:CCGGGCTGAGTTTAGAAAGTACCTTCTCGAGAAGGTACTTTCTAAACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001931.2-404s1c1
Sequence:CCGGGCAGAGGTTGAAACTGATAAACTCGAGTTTATCAGTTTCAACCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001931.2-893s1c1
Sequence:CCGGCCACTCTGTATCATTGTAGAACTCGAGTTCTACAATGATACAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)