EMAIL THIS PAGE TO A FRIEND

DLC1

deleted in liver cancer 1

210 Gene Product Result for
Synonyms: ARHGAP7 HP STARD12 p122-RhoGAP
Gene ID:
Human(10395) Summary: This gene encodes a GTPase-activating protein (GAP) that is a member of the rhoGAP family of proteins which play a role in the regulation of small GTP-binding proteins. GAP family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. This gene functions as a tumor suppressor gene in a number of common cancers, including prostate, lung, colorectal, and breast cancers. Multiple transcript variants due to alternative promoters and alternative splicing have been found for this gene.[provided by RefSeq, Apr 2010]
Mouse(50768) deleted in liver cancer 1
Rat(58834) deleted in liver cancer 1
chicken(422740) deleted in liver cancer 1
dog(475607) deleted in liver cancer 1
domestic cat(101086801) deleted in liver cancer 1
Horse(100052317) deleted in liver cancer 1
cow(511433) deleted in liver cancer 1
sheep(101123183) deleted in liver cancer 1
Domestic Rabbit(100352546) deleted in liver cancer 1
domestic guinea pig(100729904) deleted in liver cancer 1
naked mole-rat(101714040) deleted in liver cancer 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006094 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006094 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006094 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015802 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015802 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015802 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006094 Rosetta Predictions human pricing
NM_024767 Rosetta Predictions human pricing
NM_182643 Rosetta Predictions human pricing
NM_001127446 Rosetta Predictions rat pricing
NM_015802 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150945 predicted 2947
2 SASI_Hs01_00150946 predicted 3441
3 SASI_Hs01_00150947 predicted 2815
4 SASI_Hs01_00150948 predicted 2634
5 SASI_Hs01_00150949 predicted 1760
6 SASI_Hs01_00150950 predicted 853
7 SASI_Hs01_00150951 predicted 3581
8 SASI_Hs01_00150952 predicted 3145
9 SASI_Hs01_00150953 predicted 2435
10 SASI_Hs01_00150954 predicted 3212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357272 predicted 1427
2 SASI_Hs01_00227994 predicted 867
3 SASI_Hs01_00227995 predicted 712
4 SASI_Hs01_00227996 predicted 562
5 SASI_Hs01_00227997 predicted 902
6 SASI_Hs01_00227998 predicted 879
7 SASI_Hs01_00228000 predicted 717
8 SASI_Hs02_00357273 predicted 718
9 SASI_Hs01_00228001 predicted 1406
10 SASI_Hs01_00228002 predicted 1492
11 SASI_Hs01_00227999 predicted 1452
12 SASI_Hs01_00228003 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370800 predicted 1423
2 SASI_Hs01_00188171 predicted 869
3 SASI_Hs01_00188172 predicted 716
4 SASI_Hs01_00188173 predicted 564
5 SASI_Hs01_00188174 predicted 894
6 SASI_Hs01_00188175 predicted 880
7 SASI_Hs01_00188177 predicted 714
8 SASI_Hs02_00370801 predicted 715
9 SASI_Hs01_00188178 predicted 1406
10 SASI_Hs01_00188179 predicted 1495
11 SASI_Hs01_00188176 predicted 1454
12 SASI_Hs01_00188180 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127446 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253733 predicted 2840
2 SASI_Rn02_00253734 predicted 1180
3 SASI_Rn02_00253735 predicted 2909
4 SASI_Rn02_00253736 predicted 3597
5 SASI_Rn02_00253737 predicted 3660
6 SASI_Rn02_00253738 predicted 1692
7 SASI_Rn02_00253739 predicted 931
8 SASI_Rn02_00253740 predicted 2414
9 SASI_Rn02_00253741 predicted 1281
10 SASI_Rn02_00253742 predicted 2361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015802 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323173 predicted 2826
2 SASI_Mm02_00323174 predicted 1445
3 SASI_Mm02_00323175 predicted 815
4 SASI_Mm02_00323176 predicted 2531
5 SASI_Mm02_00323177 predicted 1616
6 SASI_Mm02_00323178 predicted 2379
7 SASI_Mm02_00323179 predicted 2394
8 SASI_Mm02_00323180 predicted 2519
9 SASI_Mm02_00323181 predicted 1688
10 SASI_Mm02_00323182 predicted 2788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006094
DLC1 MISSION shRNA Bacterial Glycerol Stock
deleted in liver cancer 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-2102s1c1
Sequence:CCGGGCAGAAATACTCACTCCTAAACTCGAGTTTAGGAGTGAGTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-508s1c1
Sequence:CCGGGCAGGCGTCTAAATACTTTAACTCGAGTTAAAGTATTTAGACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-2448s1c1
Sequence:CCGGGCAGACATGCTGAAGCAGTATCTCGAGATACTGCTTCAGCATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-3482s1c1
Sequence:CCGGCATGCCAGAATGGTACACAAACTCGAGTTTGTGTACCATTCTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-2881s1c1
Sequence:CCGGGCCGATGTCGTAATTCCTATACTCGAGTATAGGAATTACGACATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006094.4-2517s21c1
Sequence:CCGGTTTCTACAGATCTACCAATATCTCGAGATATTGGTAGATCTGTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006094.4-2475s21c1
Sequence:CCGGGATCTTCCTGAGCCACTAATGCTCGAGCATTAGTGGCTCAGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006094.4-3933s21c1
Sequence:CCGGGCGTACCTGTGTCGCTTTATTCTCGAGAATAAAGCGACACAGGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006094.4-3376s21c1
Sequence:CCGGTGGTGGGTGTGAGGGTTAATGCTCGAGCATTAACCCTCACACCCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006094
DLC1 MISSION shRNA shRNA Plasmid DNA
deleted in liver cancer 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-2102s1c1
Sequence:CCGGGCAGAAATACTCACTCCTAAACTCGAGTTTAGGAGTGAGTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-508s1c1
Sequence:CCGGGCAGGCGTCTAAATACTTTAACTCGAGTTAAAGTATTTAGACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-2448s1c1
Sequence:CCGGGCAGACATGCTGAAGCAGTATCTCGAGATACTGCTTCAGCATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-3482s1c1
Sequence:CCGGCATGCCAGAATGGTACACAAACTCGAGTTTGTGTACCATTCTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-2881s1c1
Sequence:CCGGGCCGATGTCGTAATTCCTATACTCGAGTATAGGAATTACGACATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006094.4-2517s21c1
Sequence:CCGGTTTCTACAGATCTACCAATATCTCGAGATATTGGTAGATCTGTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006094.4-2475s21c1
Sequence:CCGGGATCTTCCTGAGCCACTAATGCTCGAGCATTAGTGGCTCAGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006094.4-3933s21c1
Sequence:CCGGGCGTACCTGTGTCGCTTTATTCTCGAGAATAAAGCGACACAGGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006094.4-3376s21c1
Sequence:CCGGTGGTGGGTGTGAGGGTTAATGCTCGAGCATTAACCCTCACACCCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006094
DLC1 MISSION shRNA Lentiviral Transduction Particles
deleted in liver cancer 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-2102s1c1
Sequence:CCGGGCAGAAATACTCACTCCTAAACTCGAGTTTAGGAGTGAGTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-508s1c1
Sequence:CCGGGCAGGCGTCTAAATACTTTAACTCGAGTTAAAGTATTTAGACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-2448s1c1
Sequence:CCGGGCAGACATGCTGAAGCAGTATCTCGAGATACTGCTTCAGCATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-3482s1c1
Sequence:CCGGCATGCCAGAATGGTACACAAACTCGAGTTTGTGTACCATTCTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006094.3-2881s1c1
Sequence:CCGGGCCGATGTCGTAATTCCTATACTCGAGTATAGGAATTACGACATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006094.4-2517s21c1
Sequence:CCGGTTTCTACAGATCTACCAATATCTCGAGATATTGGTAGATCTGTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006094.4-2475s21c1
Sequence:CCGGGATCTTCCTGAGCCACTAATGCTCGAGCATTAGTGGCTCAGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006094.4-3933s21c1
Sequence:CCGGGCGTACCTGTGTCGCTTTATTCTCGAGAATAAAGCGACACAGGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006094.4-3376s21c1
Sequence:CCGGTGGTGGGTGTGAGGGTTAATGCTCGAGCATTAACCCTCACACCCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015802
VALIDATED
DLC1 MISSION shRNA Bacterial Glycerol Stock
deleted in liver cancer 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015802.1-314s1c2
Sequence:CCGGCCTAACACAAATTGAAGCCAACTCGAGTTGGCTTCAATTTGTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015802.1-1395s1c1
Sequence:CCGGGTGTTCTACATTCCCGAAGATCTCGAGATCTTCGGGAATGTAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015802.1-472s1c1
Sequence:CCGGGCAGGCGCTTAAATACTCTAACTCGAGTTAGAGTATTTAAGCGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015802.2-5632s1c1
Sequence:CCGGGACGACAATGACGAATCATTCCTCGAGGAATGATTCGTCATTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015802.2-1342s21c1
Sequence:CCGGGTGACGGAGCAGAACTATAAACTCGAGTTTATAGTTCTGCTCCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015802.2-5483s21c1
Sequence:CCGGATTCGGTAAGTGCACTATTAACTCGAGTTAATAGTGCACTTACCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015802.2-3098s21c1
Sequence:CCGGCTGCACCCGAGGAGATCTTAACTCGAGTTAAGATCTCCTCGGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015802.2-1609s21c1
Sequence:CCGGGATAACGTACCGGGTTCTATCCTCGAGGATAGAACCCGGTACGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015802.2-460s21c1
Sequence:CCGGGCTCTCTGCAGGCGCTTAAATCTCGAGATTTAAGCGCCTGCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015802
VALIDATED
DLC1 MISSION shRNA shRNA Plasmid DNA
deleted in liver cancer 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015802.1-314s1c2
Sequence:CCGGCCTAACACAAATTGAAGCCAACTCGAGTTGGCTTCAATTTGTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015802.1-1395s1c1
Sequence:CCGGGTGTTCTACATTCCCGAAGATCTCGAGATCTTCGGGAATGTAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015802.1-472s1c1
Sequence:CCGGGCAGGCGCTTAAATACTCTAACTCGAGTTAGAGTATTTAAGCGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015802.2-5632s1c1
Sequence:CCGGGACGACAATGACGAATCATTCCTCGAGGAATGATTCGTCATTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015802.2-1342s21c1
Sequence:CCGGGTGACGGAGCAGAACTATAAACTCGAGTTTATAGTTCTGCTCCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015802.2-5483s21c1
Sequence:CCGGATTCGGTAAGTGCACTATTAACTCGAGTTAATAGTGCACTTACCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015802.2-3098s21c1
Sequence:CCGGCTGCACCCGAGGAGATCTTAACTCGAGTTAAGATCTCCTCGGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015802.2-1609s21c1
Sequence:CCGGGATAACGTACCGGGTTCTATCCTCGAGGATAGAACCCGGTACGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015802.2-460s21c1
Sequence:CCGGGCTCTCTGCAGGCGCTTAAATCTCGAGATTTAAGCGCCTGCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015802
VALIDATED
DLC1 MISSION shRNA Lentiviral Transduction Particles
deleted in liver cancer 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015802.1-314s1c2
Sequence:CCGGCCTAACACAAATTGAAGCCAACTCGAGTTGGCTTCAATTTGTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015802.1-1395s1c1
Sequence:CCGGGTGTTCTACATTCCCGAAGATCTCGAGATCTTCGGGAATGTAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015802.1-472s1c1
Sequence:CCGGGCAGGCGCTTAAATACTCTAACTCGAGTTAGAGTATTTAAGCGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015802.2-5632s1c1
Sequence:CCGGGACGACAATGACGAATCATTCCTCGAGGAATGATTCGTCATTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015802.2-1342s21c1
Sequence:CCGGGTGACGGAGCAGAACTATAAACTCGAGTTTATAGTTCTGCTCCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015802.2-5483s21c1
Sequence:CCGGATTCGGTAAGTGCACTATTAACTCGAGTTAATAGTGCACTTACCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015802.2-3098s21c1
Sequence:CCGGCTGCACCCGAGGAGATCTTAACTCGAGTTAAGATCTCCTCGGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015802.2-1609s21c1
Sequence:CCGGGATAACGTACCGGGTTCTATCCTCGAGGATAGAACCCGGTACGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015802.2-460s21c1
Sequence:CCGGGCTCTCTGCAGGCGCTTAAATCTCGAGATTTAAGCGCCTGCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks