EMAIL THIS PAGE TO A FRIEND

DLD

dihydrolipoamide dehydrogenase

61 Gene Product Result for
Synonyms: DLDD DLDH E3 GCSL LAD PHE3
UniProtKB ID: P09622, B2R5X0, Q14131, Q14167, Q59EV8, Q8WTS4
Gene ID:
Human(1738) Summary: This gene encodes the L protein of the mitochondrial glycine cleavage system. The L protein, also named dihydrolipoamide dehydrogenase, is also a component of the pyruvate dehydrogenase complex, the alpha-ketoglutarate dehydrogenase complex, and the branched-chain alpha-keto acide dehydrogenase complex. Mutations in this gene have been identified in patients with E3-deficient maple syrup urine disease and lipoamide dehydrogenase deficiency. [provided by RefSeq, Jul 2008]
Mouse(13382) dihydrolipoamide dehydrogenase
Rat(298942) dihydrolipoamide dehydrogenase
cow(533910) dihydrolipoamide dehydrogenase
Horse(100050920) dihydrolipoamide dehydrogenase
domestic cat(101094004) dihydrolipoamide dehydrogenase
dog(403978) dihydrolipoamide dehydrogenase
chicken(417699) dihydrolipoamide dehydrogenase
naked mole-rat(101699518) dihydrolipoamide dehydrogenase
domestic guinea pig(100721798) dihydrolipoamide dehydrogenase
sheep(101105152) dihydrolipoamide dehydrogenase
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007861 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007861 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007861 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000108 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000108 Rosetta Predictions human pricing
NM_199385 Rosetta Predictions rat pricing
NM_007861 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301883 predicted 1212
2 SASI_Hs01_00189498 predicted 767
3 SASI_Hs01_00189499 predicted 818
4 SASI_Hs01_00189500 predicted 997
5 SASI_Hs02_00301884 predicted 1693
6 SASI_Hs02_00301885 predicted 447
7 SASI_Hs01_00189502 predicted 379
8 SASI_Hs01_00189503 predicted 510
9 SASI_Hs01_00189505 predicted 753
10 SASI_Hs01_00189506 predicted 775
11 SASI_Hs01_00189501 predicted 270
12 SASI_Hs01_00189504 predicted 634
13 SASI_Hs01_00189507 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103660 predicted 199
2 SASI_Rn01_00103661 predicted 1392
3 SASI_Rn01_00103665 predicted 1675
4 SASI_Rn02_00270200 predicted 300
5 SASI_Rn01_00103666 predicted 661
6 SASI_Rn01_00103667 predicted 671
7 SASI_Rn02_00270201 predicted 1510
8 SASI_Rn02_00270202 predicted 1717
9 SASI_Rn02_00270203 predicted 1691
10 SASI_Rn02_00270204 predicted 658
11 SASI_Rn01_00103662 predicted 329
12 SASI_Rn01_00103663 predicted 1075
13 SASI_Rn01_00103664 predicted 1058
14 SASI_Rn01_00103668 predicted 794
15 SASI_Rn01_00103669 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058288 predicted 684
2 SASI_Mm01_00058289 predicted 678
3 SASI_Mm01_00058290 predicted 1046
4 SASI_Mm01_00058291 predicted 988
5 SASI_Mm01_00058293 predicted 329
6 SASI_Mm02_00312637 predicted 1080
7 SASI_Mm01_00058294 predicted 801
8 SASI_Mm01_00058295 predicted 1058
9 SASI_Mm01_00058297 predicted 248
10 SASI_Mm02_00312638 predicted 284
11 SASI_Mm01_00058292 predicted 969
12 SASI_Mm01_00058296 predicted 707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007861
VALIDATED
DLD MISSION shRNA Bacterial Glycerol Stock
dihydrolipoamide dehydrogenase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007861.4-601s21c1
Sequence:CCGGATGGCAGCACTCAGGTTATTGCTCGAGCAATAACCTGAGTGCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007861.4-679s21c1
Sequence:CCGGCGATCGATGAAGATACTATAGCTCGAGCTATAGTATCTTCATCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007861.4-1791s21c1
Sequence:CCGGCGTATCTTGTTCCAGTGCATTCTCGAGAATGCACTGGAACAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007861.4-344s21c1
Sequence:CCGGCGTTGGTTGTATTCCTTCAAACTCGAGTTTGAAGGAATACAACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007861.4-999s21c1
Sequence:CCGGGCTGAAGTTATCACTTGTGATCTCGAGATCACAAGTGATAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007861.2-1752s1c1
Sequence:CCGGCGTATCTTGTTCCAGTGCATTCTCGAGAATGCACTGGAACAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007861.2-228s1c1
Sequence:CCGGGCCATCAAATCTGCCCAGTTACTCGAGTAACTGGGCAGATTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007861.2-960s1c1
Sequence:CCGGGCTGAAGTTATCACTTGTGATCTCGAGATCACAAGTGATAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007861.2-305s1c1
Sequence:CCGGCGTTGGTTGTATTCCTTCAAACTCGAGTTTGAAGGAATACAACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007861.2-696s1c1
Sequence:CCGGCCCGAGAAGCTGGTTGTTATTCTCGAGAATAACAACCAGCTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007861
VALIDATED
DLD MISSION shRNA shRNA Plasmid DNA
dihydrolipoamide dehydrogenase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007861.4-601s21c1
Sequence:CCGGATGGCAGCACTCAGGTTATTGCTCGAGCAATAACCTGAGTGCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007861.4-679s21c1
Sequence:CCGGCGATCGATGAAGATACTATAGCTCGAGCTATAGTATCTTCATCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007861.4-1791s21c1
Sequence:CCGGCGTATCTTGTTCCAGTGCATTCTCGAGAATGCACTGGAACAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007861.4-344s21c1
Sequence:CCGGCGTTGGTTGTATTCCTTCAAACTCGAGTTTGAAGGAATACAACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007861.4-999s21c1
Sequence:CCGGGCTGAAGTTATCACTTGTGATCTCGAGATCACAAGTGATAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007861.2-1752s1c1
Sequence:CCGGCGTATCTTGTTCCAGTGCATTCTCGAGAATGCACTGGAACAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007861.2-228s1c1
Sequence:CCGGGCCATCAAATCTGCCCAGTTACTCGAGTAACTGGGCAGATTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007861.2-960s1c1
Sequence:CCGGGCTGAAGTTATCACTTGTGATCTCGAGATCACAAGTGATAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007861.2-305s1c1
Sequence:CCGGCGTTGGTTGTATTCCTTCAAACTCGAGTTTGAAGGAATACAACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007861.2-696s1c1
Sequence:CCGGCCCGAGAAGCTGGTTGTTATTCTCGAGAATAACAACCAGCTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007861
VALIDATED
DLD MISSION shRNA Lentiviral Transduction Particles
dihydrolipoamide dehydrogenase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007861.4-601s21c1
Sequence:CCGGATGGCAGCACTCAGGTTATTGCTCGAGCAATAACCTGAGTGCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007861.4-679s21c1
Sequence:CCGGCGATCGATGAAGATACTATAGCTCGAGCTATAGTATCTTCATCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007861.4-1791s21c1
Sequence:CCGGCGTATCTTGTTCCAGTGCATTCTCGAGAATGCACTGGAACAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007861.4-344s21c1
Sequence:CCGGCGTTGGTTGTATTCCTTCAAACTCGAGTTTGAAGGAATACAACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007861.4-999s21c1
Sequence:CCGGGCTGAAGTTATCACTTGTGATCTCGAGATCACAAGTGATAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007861.2-1752s1c1
Sequence:CCGGCGTATCTTGTTCCAGTGCATTCTCGAGAATGCACTGGAACAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007861.2-228s1c1
Sequence:CCGGGCCATCAAATCTGCCCAGTTACTCGAGTAACTGGGCAGATTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007861.2-960s1c1
Sequence:CCGGGCTGAAGTTATCACTTGTGATCTCGAGATCACAAGTGATAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007861.2-305s1c1
Sequence:CCGGCGTTGGTTGTATTCCTTCAAACTCGAGTTTGAAGGAATACAACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007861.2-696s1c1
Sequence:CCGGCCCGAGAAGCTGGTTGTTATTCTCGAGAATAACAACCAGCTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000108
VALIDATED
DLD MISSION shRNA Bacterial Glycerol Stock
dihydrolipoamide dehydrogenase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-613s21c1
Sequence:CCGGATGGCGGCACTCAGGTTATTGCTCGAGCAATAACCTGAGTGCCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-1488s21c1
Sequence:CCGGGCTGGAGAAATGGTAAATGAACTCGAGTTCATTTACCATTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-1331s21c1
Sequence:CCGGGCAGTTGAAAGAAGAGGGTATCTCGAGATACCCTCTTCTTTCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-1885s21c1
Sequence:CCGGTATCTCCGTCAACTCATATTTCTCGAGAAATATGAGTTGACGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-1599s21c1
Sequence:CCGGGCAAATCTTGCTGCGTCATTTCTCGAGAAATGACGCAGCAAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000108.2-743s1c1
Sequence:CCGGGCAGGAGTAATAGGTGTAGAACTCGAGTTCTACACCTATTACTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000108.2-1460s1c1
Sequence:CCGGGCTGGAGAAATGGTAAATGAACTCGAGTTCATTTACCATTTCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000108.2-497s1c1
Sequence:CCGGGCCCACTTATTCAAACAGAATCTCGAGATTCTGTTTGAATAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000108.2-1303s1c1
Sequence:CCGGGCAGTTGAAAGAAGAGGGTATCTCGAGATACCCTCTTCTTTCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000108
VALIDATED
DLD MISSION shRNA shRNA Plasmid DNA
dihydrolipoamide dehydrogenase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-613s21c1
Sequence:CCGGATGGCGGCACTCAGGTTATTGCTCGAGCAATAACCTGAGTGCCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-1488s21c1
Sequence:CCGGGCTGGAGAAATGGTAAATGAACTCGAGTTCATTTACCATTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-1331s21c1
Sequence:CCGGGCAGTTGAAAGAAGAGGGTATCTCGAGATACCCTCTTCTTTCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-1885s21c1
Sequence:CCGGTATCTCCGTCAACTCATATTTCTCGAGAAATATGAGTTGACGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-1599s21c1
Sequence:CCGGGCAAATCTTGCTGCGTCATTTCTCGAGAAATGACGCAGCAAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000108.2-743s1c1
Sequence:CCGGGCAGGAGTAATAGGTGTAGAACTCGAGTTCTACACCTATTACTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000108.2-1460s1c1
Sequence:CCGGGCTGGAGAAATGGTAAATGAACTCGAGTTCATTTACCATTTCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000108.2-497s1c1
Sequence:CCGGGCCCACTTATTCAAACAGAATCTCGAGATTCTGTTTGAATAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000108.2-1303s1c1
Sequence:CCGGGCAGTTGAAAGAAGAGGGTATCTCGAGATACCCTCTTCTTTCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000108
VALIDATED
DLD MISSION shRNA Lentiviral Transduction Particles
dihydrolipoamide dehydrogenase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-613s21c1
Sequence:CCGGATGGCGGCACTCAGGTTATTGCTCGAGCAATAACCTGAGTGCCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-1488s21c1
Sequence:CCGGGCTGGAGAAATGGTAAATGAACTCGAGTTCATTTACCATTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-1331s21c1
Sequence:CCGGGCAGTTGAAAGAAGAGGGTATCTCGAGATACCCTCTTCTTTCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-1885s21c1
Sequence:CCGGTATCTCCGTCAACTCATATTTCTCGAGAAATATGAGTTGACGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000108.3-1599s21c1
Sequence:CCGGGCAAATCTTGCTGCGTCATTTCTCGAGAAATGACGCAGCAAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000108.2-743s1c1
Sequence:CCGGGCAGGAGTAATAGGTGTAGAACTCGAGTTCTACACCTATTACTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000108.2-1460s1c1
Sequence:CCGGGCTGGAGAAATGGTAAATGAACTCGAGTTCATTTACCATTTCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000108.2-497s1c1
Sequence:CCGGGCCCACTTATTCAAACAGAATCTCGAGATTCTGTTTGAATAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000108.2-1303s1c1
Sequence:CCGGGCAGTTGAAAGAAGAGGGTATCTCGAGATACCCTCTTCTTTCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks