EMAIL THIS PAGE TO A FRIEND

DLEC1

deleted in lung and esophageal cancer 1

111 Gene Product Result for
Synonyms: DLC1 F56
UniProtKB ID: Q9Y238, Q9NSW0, Q9NTG5
Gene ID:
Human(9940) Summary: This gene contains 37 exons, spans approximately 59-kb, and is located in the 3p22-p21.3 chromosomal segment that is commonly deleted in various carcinomas. Several alternatively spliced transcripts have been observed that contain disrupted coding regions and likely encode nonfunctional proteins. Aberrant transcription of this gene may be involved in carcinogenesis of the lung, esophagus, and kidney. [provided by RefSeq, Jul 2008]
Mouse(320256) deleted in lung and esophageal cancer 1
Rat(501070) deleted in lung and esophageal cancer 1
Zebrafish(555583) deleted in lung and esophageal cancer 1
chicken(420418) deleted in lung and esophageal cancer 1
domestic cat(101090287) deleted in lung and esophageal cancer 1
cow(618746) deleted in lung and esophageal cancer 1
Horse(100054035) deleted in lung and esophageal cancer 1
dog(100686697) deleted in lung and esophageal cancer 1
sheep(101115235) deleted in lung and esophageal cancer 1
domestic guinea pig(100716095) deleted in lung and esophageal cancer 1
naked mole-rat(101702670) deleted in lung and esophageal cancer 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005106 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007335 Rosetta Predictions human pricing
NM_007337 Rosetta Predictions human pricing
XM_001062041 Rosetta Predictions rat pricing
XM_001077365 Rosetta Predictions rat pricing
XM_486268 Rosetta Predictions mouse pricing
XM_916519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219766 predicted 3247
2 SASI_Hs01_00219767 predicted 1573
3 SASI_Hs01_00219768 predicted 3547
4 SASI_Hs01_00219769 predicted 1908
5 SASI_Hs01_00219770 predicted 3053
6 SASI_Hs01_00219771 predicted 657
7 SASI_Hs01_00219772 predicted 1802
8 SASI_Hs01_00219773 predicted 2119
9 SASI_Hs01_00219774 predicted 2888
10 SASI_Hs01_00219775 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182182 predicted 3247
2 SASI_Hs01_00182183 predicted 1571
3 SASI_Hs01_00182184 predicted 3546
4 SASI_Hs01_00182185 predicted 1906
5 SASI_Hs01_00182186 predicted 3052
6 SASI_Hs01_00182187 predicted 658
7 SASI_Hs01_00182188 predicted 1798
8 SASI_Hs01_00182189 predicted 2120
9 SASI_Hs01_00182190 predicted 2890
10 SASI_Hs01_00182191 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302169 predicted 2855
2 SASI_Rn02_00302170 predicted 3343
3 SASI_Rn02_00302171 predicted 2971
4 SASI_Rn02_00302172 predicted 3332
5 SASI_Rn02_00302173 predicted 4042
6 SASI_Rn02_00302174 predicted 2460
7 SASI_Rn02_00302175 predicted 3173
8 SASI_Rn02_00302176 predicted 2357
9 SASI_Rn02_00302177 predicted 2651
10 SASI_Rn02_00302178 predicted 3339
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356800 predicted 2307
2 SASI_Rn02_00356801 predicted 3858
3 SASI_Rn02_00356802 predicted 888
4 SASI_Rn02_00356803 predicted 3488
5 SASI_Rn02_00356804 predicted 3840
6 SASI_Rn02_00356805 predicted 1125
7 SASI_Rn02_00356806 predicted 2962
8 SASI_Rn02_00356807 predicted 1618
9 SASI_Rn02_00356808 predicted 2868
10 SASI_Rn02_00356809 predicted 2285
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235834 predicted 2557
2 SASI_Mm01_00235835 predicted 2139
3 SASI_Mm01_00235838 predicted 4501
4 SASI_Mm01_00235839 predicted 3518
5 SASI_Mm01_00235840 predicted 3049
6 SASI_Mm02_00426850 predicted 4289
7 SASI_Mm01_00235841 predicted 1710
8 SASI_Mm01_00235842 predicted 1907
9 SASI_Mm01_00235843 predicted 3113
10 SASI_Mm02_00426851 predicted 1626
11 SASI_Mm01_00235836 predicted 620
12 SASI_Mm01_00235837 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440350 predicted 2558
2 SASI_Mm02_00440351 predicted 2142
3 SASI_Mm02_00440352 predicted 613
4 SASI_Mm02_00440353 predicted 477
5 SASI_Mm02_00440354 predicted 4499
6 SASI_Mm02_00440355 predicted 3521
7 SASI_Mm02_00440356 predicted 3047
8 SASI_Mm02_00440357 predicted 1717
9 SASI_Mm02_00440358 predicted 1905
10 SASI_Mm02_00440359 predicted 3115
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005106
DLEC1 MISSION shRNA Bacterial Glycerol Stock
deleted in lung and esophageal cancer 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005106.2-1610s1c1
Sequence:CCGGGCTTTGTTGAACAACCTCCTTCTCGAGAAGGAGGTTGTTCAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005106.2-5452s1c1
Sequence:CCGGCCCTCATGATTTGTCCTCAGACTCGAGTCTGAGGACAAATCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005106.2-1183s1c1
Sequence:CCGGCCAGTTTATGAGATGGTAATTCTCGAGAATTACCATCTCATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005106.2-3571s1c1
Sequence:CCGGGCTGCTTTCTTCCCTCACTTTCTCGAGAAAGTGAGGGAAGAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005106.2-646s1c1
Sequence:CCGGCCAGAAGATTACTACACCGATCTCGAGATCGGTGTAGTAATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005106
DLEC1 MISSION shRNA shRNA Plasmid DNA
deleted in lung and esophageal cancer 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005106.2-1610s1c1
Sequence:CCGGGCTTTGTTGAACAACCTCCTTCTCGAGAAGGAGGTTGTTCAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005106.2-5452s1c1
Sequence:CCGGCCCTCATGATTTGTCCTCAGACTCGAGTCTGAGGACAAATCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005106.2-1183s1c1
Sequence:CCGGCCAGTTTATGAGATGGTAATTCTCGAGAATTACCATCTCATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005106.2-3571s1c1
Sequence:CCGGGCTGCTTTCTTCCCTCACTTTCTCGAGAAAGTGAGGGAAGAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005106.2-646s1c1
Sequence:CCGGCCAGAAGATTACTACACCGATCTCGAGATCGGTGTAGTAATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005106
DLEC1 MISSION shRNA Lentiviral Transduction Particles
deleted in lung and esophageal cancer 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005106.2-1610s1c1
Sequence:CCGGGCTTTGTTGAACAACCTCCTTCTCGAGAAGGAGGTTGTTCAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005106.2-5452s1c1
Sequence:CCGGCCCTCATGATTTGTCCTCAGACTCGAGTCTGAGGACAAATCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005106.2-1183s1c1
Sequence:CCGGCCAGTTTATGAGATGGTAATTCTCGAGAATTACCATCTCATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005106.2-3571s1c1
Sequence:CCGGGCTGCTTTCTTCCCTCACTTTCTCGAGAAAGTGAGGGAAGAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005106.2-646s1c1
Sequence:CCGGCCAGAAGATTACTACACCGATCTCGAGATCGGTGTAGTAATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177117
DLEC1 MISSION shRNA Bacterial Glycerol Stock
deleted in lung and esophageal cancer 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-619s21c1
Sequence:CCGGGTGTCTAGACAGCAAGTTAATCTCGAGATTAACTTGCTGTCTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-2458s21c1
Sequence:CCGGGCCCAATGAGGTCGGAGATTTCTCGAGAAATCTCCGACCTCATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-171s21c1
Sequence:CCGGTGCATTCCTCGACCGTCTTAACTCGAGTTAAGACGGTCGAGGAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-1171s21c1
Sequence:CCGGTTACGAAATTGGACCCGTTTACTCGAGTAAACGGGTCCAATTTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-4764s21c1
Sequence:CCGGTGTTGCCCGGAGTGGATATTCCTCGAGGAATATCCACTCCGGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177117
DLEC1 MISSION shRNA shRNA Plasmid DNA
deleted in lung and esophageal cancer 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-619s21c1
Sequence:CCGGGTGTCTAGACAGCAAGTTAATCTCGAGATTAACTTGCTGTCTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-2458s21c1
Sequence:CCGGGCCCAATGAGGTCGGAGATTTCTCGAGAAATCTCCGACCTCATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-171s21c1
Sequence:CCGGTGCATTCCTCGACCGTCTTAACTCGAGTTAAGACGGTCGAGGAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-1171s21c1
Sequence:CCGGTTACGAAATTGGACCCGTTTACTCGAGTAAACGGGTCCAATTTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-4764s21c1
Sequence:CCGGTGTTGCCCGGAGTGGATATTCCTCGAGGAATATCCACTCCGGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177117
DLEC1 MISSION shRNA Lentiviral Transduction Particles
deleted in lung and esophageal cancer 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-619s21c1
Sequence:CCGGGTGTCTAGACAGCAAGTTAATCTCGAGATTAACTTGCTGTCTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-2458s21c1
Sequence:CCGGGCCCAATGAGGTCGGAGATTTCTCGAGAAATCTCCGACCTCATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-171s21c1
Sequence:CCGGTGCATTCCTCGACCGTCTTAACTCGAGTTAAGACGGTCGAGGAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-1171s21c1
Sequence:CCGGTTACGAAATTGGACCCGTTTACTCGAGTAAACGGGTCCAATTTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177117.3-4764s21c1
Sequence:CCGGTGTTGCCCGGAGTGGATATTCCTCGAGGAATATCCACTCCGGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks