EMAIL THIS PAGE TO A FRIEND

DLEU1

deleted in lymphocytic leukemia 1 (non-protein coding)

15 Gene Product Result for
Synonyms: BCMS DLB1 DLEU2 LEU1 LEU2 LINC00021 NCRNA00021 XTP6
Species: Human DLEU1(10301)
UniProtKB ID: O43261, Q547G6, Q8TE10, Q96QY5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0010301M2 Monoclonal Anti-DLEU1 antibody produced in mouse clone 2C2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005887 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130841 MISSION® esiRNA esiRNA human DLEU1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002605 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00376289 predicted 571
2 SASI_Hs02_00376290 predicted 572
3 SASI_Hs02_00376291 predicted 502
4 SASI_Hs02_00376292 predicted 572
5 SASI_Hs02_00376293 predicted 478
6 SASI_Hs02_00376294 predicted 545
7 SASI_Hs02_00376295 predicted 559
8 SASI_Hs02_00376296 predicted 501
9 SASI_Hs02_00376297 predicted 536
10 SASI_Hs02_00376298 predicted 499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005887
VALIDATED
DLEU1 MISSION shRNA Bacterial Glycerol Stock
deleted in lymphocytic leukemia 1 (non-protein coding)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-369s1c1
Sequence:CCGGCCTCGGAACAACTTTACCAGTCTCGAGACTGGTAAAGTTGTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-431s1c1
Sequence:CCGGTGAGTCACAATGCAGACAAATCTCGAGATTTGTCTGCATTGTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-733s1c1
Sequence:CCGGCCAGCATGTTTCTCCCATTTACTCGAGTAAATGGGAGAAACATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-445s1c1
Sequence:CCGGGACAAATATCAAATGGGAGATCTCGAGATCTCCCATTTGATATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-462s1c1
Sequence:CCGGAGATTGTTGCAAGGAAGAGATCTCGAGATCTCTTCCTTGCAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005887
VALIDATED
DLEU1 MISSION shRNA shRNA Plasmid DNA
deleted in lymphocytic leukemia 1 (non-protein coding)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-369s1c1
Sequence:CCGGCCTCGGAACAACTTTACCAGTCTCGAGACTGGTAAAGTTGTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-431s1c1
Sequence:CCGGTGAGTCACAATGCAGACAAATCTCGAGATTTGTCTGCATTGTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-733s1c1
Sequence:CCGGCCAGCATGTTTCTCCCATTTACTCGAGTAAATGGGAGAAACATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-445s1c1
Sequence:CCGGGACAAATATCAAATGGGAGATCTCGAGATCTCCCATTTGATATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-462s1c1
Sequence:CCGGAGATTGTTGCAAGGAAGAGATCTCGAGATCTCTTCCTTGCAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005887
VALIDATED
DLEU1 MISSION shRNA Lentiviral Transduction Particles
deleted in lymphocytic leukemia 1 (non-protein coding)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-369s1c1
Sequence:CCGGCCTCGGAACAACTTTACCAGTCTCGAGACTGGTAAAGTTGTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-431s1c1
Sequence:CCGGTGAGTCACAATGCAGACAAATCTCGAGATTTGTCTGCATTGTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-733s1c1
Sequence:CCGGCCAGCATGTTTCTCCCATTTACTCGAGTAAATGGGAGAAACATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-445s1c1
Sequence:CCGGGACAAATATCAAATGGGAGATCTCGAGATCTCCCATTTGATATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005887.1-462s1c1
Sequence:CCGGAGATTGTTGCAAGGAAGAGATCTCGAGATCTCTTCCTTGCAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks