EMAIL THIS PAGE TO A FRIEND

DLEU2

deleted in lymphocytic leukemia 2 (non-protein coding)

32 Gene Product Result for
Synonyms: 1B4 BCMSUN DLB2 LEU2 LINC00022 MIR15AHG NCRNA00022 RFP2OS TRIM13OS
Gene ID:
Mouse(668253) deleted in lymphocytic leukemia, 2
Rat(691928) deleted in lymphocytic leukemia 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006021 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002612 Rosetta Predictions human pricing
XM_001080151 Rosetta Predictions rat pricing
XM_001000367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00376299 predicted 1541
2 SASI_Hs02_00376300 predicted 1472
3 SASI_Hs02_00376301 predicted 1500
4 SASI_Hs02_00376302 predicted 1350
5 SASI_Hs02_00376303 predicted 1420
6 SASI_Hs02_00376304 predicted 793
7 SASI_Hs02_00376305 predicted 787
8 SASI_Hs02_00376306 predicted 763
9 SASI_Hs02_00376307 predicted 1467
10 SASI_Hs02_00376308 predicted 1367
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366824 predicted 228
2 SASI_Rn02_00366825 predicted 215
3 SASI_Rn02_00366826 predicted 229
4 SASI_Rn02_00366827 predicted 200
5 SASI_Rn02_00366828 predicted 229
6 SASI_Rn02_00366829 predicted 222
7 SASI_Rn02_00366830 predicted 293
8 SASI_Rn02_00366831 predicted 216
9 SASI_Rn02_00366832 predicted 213
10 SASI_Rn02_00366833 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225460 predicted 704
2 SASI_Mm01_00225461 predicted 707
3 SASI_Mm01_00225462 predicted 732
4 SASI_Mm01_00225463 predicted 742
5 SASI_Mm01_00225464 predicted 705
6 SASI_Mm01_00225465 predicted 707
7 SASI_Mm01_00225466 predicted 737
8 SASI_Mm01_00225467 predicted 699
9 SASI_Mm01_00225468 predicted 733
10 SASI_Mm01_00225469 predicted 728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006021
DLEU2 MISSION shRNA Bacterial Glycerol Stock
deleted in lymphocytic leukemia 2 (non-protein coding)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006021.1-959s1c1
Sequence:CCGGCCTCTAATTCTGTAGGACTTTCTCGAGAAAGTCCTACAGAATTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006021.1-296s1c1
Sequence:CCGGTCCTTAGCTCAGCAATTCTTACTCGAGTAAGAATTGCTGAGCTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006021.1-301s1c1
Sequence:CCGGAGCTCAGCAATTCTTACCTTTCTCGAGAAAGGTAAGAATTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006021.1-348s1c1
Sequence:CCGGTGAAAGGTGTACTGCAAGGAACTCGAGTTCCTTGCAGTACACCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006021.1-398s1c1
Sequence:CCGGCAAGGGTGGATAATTACTGTACTCGAGTACAGTAATTATCCACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006021
DLEU2 MISSION shRNA shRNA Plasmid DNA
deleted in lymphocytic leukemia 2 (non-protein coding)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006021.1-959s1c1
Sequence:CCGGCCTCTAATTCTGTAGGACTTTCTCGAGAAAGTCCTACAGAATTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006021.1-296s1c1
Sequence:CCGGTCCTTAGCTCAGCAATTCTTACTCGAGTAAGAATTGCTGAGCTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006021.1-301s1c1
Sequence:CCGGAGCTCAGCAATTCTTACCTTTCTCGAGAAAGGTAAGAATTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006021.1-348s1c1
Sequence:CCGGTGAAAGGTGTACTGCAAGGAACTCGAGTTCCTTGCAGTACACCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006021.1-398s1c1
Sequence:CCGGCAAGGGTGGATAATTACTGTACTCGAGTACAGTAATTATCCACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006021
DLEU2 MISSION shRNA Lentiviral Transduction Particles
deleted in lymphocytic leukemia 2 (non-protein coding)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006021.1-959s1c1
Sequence:CCGGCCTCTAATTCTGTAGGACTTTCTCGAGAAAGTCCTACAGAATTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006021.1-296s1c1
Sequence:CCGGTCCTTAGCTCAGCAATTCTTACTCGAGTAAGAATTGCTGAGCTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006021.1-301s1c1
Sequence:CCGGAGCTCAGCAATTCTTACCTTTCTCGAGAAAGGTAAGAATTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006021.1-348s1c1
Sequence:CCGGTGAAAGGTGTACTGCAAGGAACTCGAGTTCCTTGCAGTACACCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006021.1-398s1c1
Sequence:CCGGCAAGGGTGGATAATTACTGTACTCGAGTACAGTAATTATCCACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks