EMAIL THIS PAGE TO A FRIEND

DLEU7

deleted in lymphocytic leukemia, 7

140 Gene Product Result for
UniProtKB ID: Q6UYE1, Q2M2E4, Q6ZT82
Gene ID:
Mouse(239133) deleted in lymphocytic leukemia, 7
Rat(290308) deleted in lymphocytic leukemia, 7
chicken(101665307) deleted in lymphocytic leukemia, 7
cow(787562) deleted in lymphocytic leukemia, 7
domestic cat(101099098) deleted in lymphocytic leukemia, 7
chicken(101750559) deleted in lymphocytic leukemia, 7
domestic guinea pig(100720186) deleted in lymphocytic leukemia, 7
naked mole-rat(101718531) deleted in lymphocytic leukemia, 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198989 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198989 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198989 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198989 Rosetta Predictions human pricing
NM_001106043 Rosetta Predictions rat pricing
XM_214218 Rosetta Predictions rat pricing
NM_173419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140557 predicted 845
2 SASI_Hs01_00140558 predicted 829
3 SASI_Hs02_00372496 predicted 604
4 SASI_Hs02_00372497 predicted 708
5 SASI_Hs01_00140560 predicted 763
6 SASI_Hs02_00372498 predicted 660
7 SASI_Hs01_00140563 predicted 686
8 SASI_Hs02_00372499 predicted 661
9 SASI_Hs02_00372500 predicted 772
10 SASI_Hs02_00372501 predicted 603
11 SASI_Hs01_00140559 predicted 1189
12 SASI_Hs01_00140561 predicted 1220
13 SASI_Hs01_00140562 predicted 1189
14 SASI_Hs01_00140564 predicted 1176
15 SASI_Hs01_00140565 predicted 1141
16 SASI_Hs01_00140566 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215062 predicted 968
2 SASI_Rn02_00215063 predicted 775
3 SASI_Rn02_00215064 predicted 1248
4 SASI_Rn02_00215065 predicted 1277
5 SASI_Rn02_00215066 predicted 1327
6 SASI_Rn02_00215067 predicted 839
7 SASI_Rn02_00215068 predicted 859
8 SASI_Rn02_00215069 predicted 1028
9 SASI_Rn02_00215070 predicted 1017
10 SASI_Rn02_00215071 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169556 predicted 1264
2 SASI_Rn01_00169557 predicted 1301
3 SASI_Rn01_00169558 predicted 1144
4 SASI_Rn01_00169559 predicted 1173
5 SASI_Rn01_00169560 predicted 1219
6 SASI_Rn01_00169561 predicted 1223
7 SASI_Rn01_00169562 predicted 1173
8 SASI_Rn01_00169563 predicted 1138
9 SASI_Rn01_00169564 predicted 1325
10 SASI_Rn01_00169565 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113471 predicted 794
2 SASI_Mm01_00113474 predicted 847
3 SASI_Mm01_00113475 predicted 894
4 SASI_Mm01_00113476 predicted 693
5 SASI_Mm01_00113477 predicted 444
6 SASI_Mm01_00113478 predicted 933
7 SASI_Mm02_00345295 predicted 559
8 SASI_Mm02_00345296 predicted 912
9 SASI_Mm02_00345297 predicted 798
10 SASI_Mm02_00345298 predicted 472
11 SASI_Mm01_00113470 predicted 507
12 SASI_Mm01_00113472 predicted 865
13 SASI_Mm01_00113473 predicted 627
14 SASI_Mm01_00113479 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173419
DLEU7 MISSION shRNA Bacterial Glycerol Stock
deleted in lymphocytic leukemia, 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173419.1-450s1c1
Sequence:CCGGGCGTGGAATTTAGAAACATCTCTCGAGAGATGTTTCTAAATTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173419.1-559s1c1
Sequence:CCGGGTTGATCCAGTCACTTGCTAACTCGAGTTAGCAAGTGACTGGATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173419.1-989s1c1
Sequence:CCGGGTCAGCTATAAGGCTTAATAGCTCGAGCTATTAAGCCTTATAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173419.1-895s21c1
Sequence:CCGGGGGAGCTAATTGGACTATATACTCGAGTATATAGTCCAATTAGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173419.1-440s21c1
Sequence:CCGGCTGAAGGATAGCGTGGAATTTCTCGAGAAATTCCACGCTATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173419.1-476s21c1
Sequence:CCGGCACTTGGCTCTGCAGATTGAACTCGAGTTCAATCTGCAGAGCCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173419.1-560s21c1
Sequence:CCGGTTGATCCAGTCACTTGCTAATCTCGAGATTAGCAAGTGACTGGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173419.1-631s21c1
Sequence:CCGGACAGAATCTCCCAGATGTATGCTCGAGCATACATCTGGGAGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173419
DLEU7 MISSION shRNA shRNA Plasmid DNA
deleted in lymphocytic leukemia, 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173419.1-450s1c1
Sequence:CCGGGCGTGGAATTTAGAAACATCTCTCGAGAGATGTTTCTAAATTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173419.1-559s1c1
Sequence:CCGGGTTGATCCAGTCACTTGCTAACTCGAGTTAGCAAGTGACTGGATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173419.1-989s1c1
Sequence:CCGGGTCAGCTATAAGGCTTAATAGCTCGAGCTATTAAGCCTTATAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173419.1-895s21c1
Sequence:CCGGGGGAGCTAATTGGACTATATACTCGAGTATATAGTCCAATTAGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173419.1-440s21c1
Sequence:CCGGCTGAAGGATAGCGTGGAATTTCTCGAGAAATTCCACGCTATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173419.1-476s21c1
Sequence:CCGGCACTTGGCTCTGCAGATTGAACTCGAGTTCAATCTGCAGAGCCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173419.1-560s21c1
Sequence:CCGGTTGATCCAGTCACTTGCTAATCTCGAGATTAGCAAGTGACTGGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173419.1-631s21c1
Sequence:CCGGACAGAATCTCCCAGATGTATGCTCGAGCATACATCTGGGAGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173419
DLEU7 MISSION shRNA Lentiviral Transduction Particles
deleted in lymphocytic leukemia, 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173419.1-450s1c1
Sequence:CCGGGCGTGGAATTTAGAAACATCTCTCGAGAGATGTTTCTAAATTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173419.1-559s1c1
Sequence:CCGGGTTGATCCAGTCACTTGCTAACTCGAGTTAGCAAGTGACTGGATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173419.1-989s1c1
Sequence:CCGGGTCAGCTATAAGGCTTAATAGCTCGAGCTATTAAGCCTTATAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173419.1-895s21c1
Sequence:CCGGGGGAGCTAATTGGACTATATACTCGAGTATATAGTCCAATTAGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173419.1-440s21c1
Sequence:CCGGCTGAAGGATAGCGTGGAATTTCTCGAGAAATTCCACGCTATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173419.1-476s21c1
Sequence:CCGGCACTTGGCTCTGCAGATTGAACTCGAGTTCAATCTGCAGAGCCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173419.1-560s21c1
Sequence:CCGGTTGATCCAGTCACTTGCTAATCTCGAGATTAGCAAGTGACTGGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173419.1-631s21c1
Sequence:CCGGACAGAATCTCCCAGATGTATGCTCGAGCATACATCTGGGAGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198989
DLEU7 MISSION shRNA Bacterial Glycerol Stock
deleted in lymphocytic leukemia, 7
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-979s1c1
Sequence:CCGGCGCCACAAATCATCCTGCTTTCTCGAGAAAGCAGGATGATTTGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-752s1c1
Sequence:CCGGGCTTCAACTCCTGGCTAATGACTCGAGTCATTAGCCAGGAGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172541    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-749s1c1
Sequence:CCGGGAAGCTTCAACTCCTGGCTAACTCGAGTTAGCCAGGAGTTGAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-734s1c1
Sequence:CCGGCTTTCCCATTCACCTGAAGCTCTCGAGAGCTTCAGGTGAATGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173106    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-1087s1c1
Sequence:CCGGCCCTGTTTGCTCTTCAGGAAACTCGAGTTTCCTGAAGAGCAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198989.2-141s21c1
Sequence:CCGGACCAAATGGTGGCTCTGCAGACTCGAGTCTGCAGAGCCACCATTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198989
DLEU7 MISSION shRNA shRNA Plasmid DNA
deleted in lymphocytic leukemia, 7
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-979s1c1
Sequence:CCGGCGCCACAAATCATCCTGCTTTCTCGAGAAAGCAGGATGATTTGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-752s1c1
Sequence:CCGGGCTTCAACTCCTGGCTAATGACTCGAGTCATTAGCCAGGAGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172541    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-749s1c1
Sequence:CCGGGAAGCTTCAACTCCTGGCTAACTCGAGTTAGCCAGGAGTTGAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-734s1c1
Sequence:CCGGCTTTCCCATTCACCTGAAGCTCTCGAGAGCTTCAGGTGAATGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173106    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-1087s1c1
Sequence:CCGGCCCTGTTTGCTCTTCAGGAAACTCGAGTTTCCTGAAGAGCAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198989.2-141s21c1
Sequence:CCGGACCAAATGGTGGCTCTGCAGACTCGAGTCTGCAGAGCCACCATTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198989
DLEU7 MISSION shRNA Lentiviral Transduction Particles
deleted in lymphocytic leukemia, 7
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-979s1c1
Sequence:CCGGCGCCACAAATCATCCTGCTTTCTCGAGAAAGCAGGATGATTTGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-752s1c1
Sequence:CCGGGCTTCAACTCCTGGCTAATGACTCGAGTCATTAGCCAGGAGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172541    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-749s1c1
Sequence:CCGGGAAGCTTCAACTCCTGGCTAACTCGAGTTAGCCAGGAGTTGAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-734s1c1
Sequence:CCGGCTTTCCCATTCACCTGAAGCTCTCGAGAGCTTCAGGTGAATGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173106    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198989.1-1087s1c1
Sequence:CCGGCCCTGTTTGCTCTTCAGGAAACTCGAGTTTCCTGAAGAGCAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198989.2-141s21c1
Sequence:CCGGACCAAATGGTGGCTCTGCAGACTCGAGTCTGCAGAGCCACCATTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks