EMAIL THIS PAGE TO A FRIEND

DLG1

discs, large homolog 1 (Drosophila)

Synonyms: DLGH1 SAP-97 SAP97 dJ1061C18.1.1 hdlg
Gene ID:
Human(1739) Summary: This gene encodes a multi-domain scaffolding protein that is required for normal development. This protein may have a role in septate junction formation, signal transduction, cell proliferation, synaptogenesis and lymphocyte activation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene, but the full-length nature of some of the variants is not known. [provided by RefSeq, Feb 2011]
Mouse(13383) discs, large homolog 1 (Drosophila)
Rat(25252) discs, large homolog 1 (Drosophila)
Zebrafish(114446) discs, large (Drosophila) homolog 1
chicken(424890) discs, large homolog 1 (Drosophila)
domestic cat(101084051) discs, large homolog 1 (Drosophila)
cow(785291) discs, large homolog 1 (Drosophila)
Horse(100060094) discs, large homolog 1 (Drosophila)
dog(488036) discs, large homolog 1 (Drosophila)
fruit fly(32083) discs large 1
naked mole-rat(101716409) discs, large homolog 1 (Drosophila)
domestic guinea pig(100721554) discs, large homolog 1 (Drosophila)
sheep(101103028) discs, large homolog 1 (Drosophila)
Domestic Rabbit(100339253) discs, large homolog 1 (Drosophila)
Gene Class: Cell_Adhesion
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004087 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135311 MISSION® esiRNA esiRNA human DLG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098424 Rosetta Predictions human pricing
NM_004087 Rosetta Predictions human pricing
NM_012788 Rosetta Predictions rat pricing
NM_007862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318909 predicted 878
2 SASI_Hs02_00318910 predicted 357
3 SASI_Hs02_00318911 predicted 594
4 SASI_Hs02_00318912 predicted 2533
5 SASI_Hs02_00318913 predicted 1931
6 SASI_Hs02_00318914 predicted 2569
7 SASI_Hs02_00318915 predicted 1402
8 SASI_Hs02_00318916 predicted 1350
9 SASI_Hs02_00318917 predicted 1712
10 SASI_Hs02_00318918 predicted 1413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128292 predicted 877
2 SASI_Hs01_00128294 predicted 359
3 SASI_Hs02_00336885 predicted 602
4 SASI_Hs01_00128295 predicted 2595
5 SASI_Hs01_00128298 predicted 1936
6 SASI_Hs02_00336886 predicted 2628
7 SASI_Hs02_00336887 predicted 1396
8 SASI_Hs01_00128299 predicted 1356
9 SASI_Hs01_00128300 predicted 1712
10 SASI_Hs02_00336888 predicted 1406
11 SASI_Hs01_00128291 predicted 2189
12 SASI_Hs01_00128293 predicted 922
13 SASI_Hs01_00128296 predicted 2109
14 SASI_Hs01_00128297 predicted 2422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012788 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030929 predicted 2191
2 SASI_Rn02_00260207 predicted 619
3 SASI_Rn01_00030932 predicted 1138
4 SASI_Rn02_00260208 predicted 1549
5 SASI_Rn02_00260209 predicted 2724
6 SASI_Rn01_00030933 predicted 2630
7 SASI_Rn01_00030934 predicted 506
8 SASI_Rn01_00030935 predicted 2269
9 SASI_Rn01_00030936 predicted 1073
10 SASI_Rn01_00030937 predicted 2573
11 SASI_Rn01_00030928 predicted 2936
12 SASI_Rn01_00030930 predicted 495
13 SASI_Rn01_00030931 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312639 predicted 2787
2 SASI_Mm01_00117491 predicted 1416
3 SASI_Mm01_00117492 predicted 1202
4 SASI_Mm01_00117493 predicted 487
5 SASI_Mm01_00117495 predicted 962
6 SASI_Mm01_00117496 predicted 2635
7 SASI_Mm01_00117498 predicted 2544
8 SASI_Mm01_00117499 predicted 1112
9 SASI_Mm02_00312640 predicted 370
10 SASI_Mm01_00117500 predicted 3083
11 SASI_Mm01_00117494 predicted 1446
12 SASI_Mm01_00117497 predicted 1347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007862
VALIDATED
DLG1 MISSION shRNA Bacterial Glycerol Stock
discs, large homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007862.2-658s21c1
Sequence:CCGGTACTTCCTCCTGAGCATATTTCTCGAGAAATATGCTCAGGAGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007862.2-3242s21c1
Sequence:CCGGGTTGCATCATCTGTACTATTCCTCGAGGAATAGTACAGATGATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007862.2-1929s21c1
Sequence:CCGGGTCACCATCGTTGCGCAATATCTCGAGATATTGCGCAACGATGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007862.2-2523s21c1
Sequence:CCGGACCCGACCAGTCATCATATTACTCGAGTAATATGATGACTGGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007862.2-442s21c1
Sequence:CCGGGCAACCTCTTTCAGGCTTTAACTCGAGTTAAAGCCTGAAAGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007862.2-442s1c1
Sequence:CCGGGCAACCTCTTTCAGGCTTTAACTCGAGTTAAAGCCTGAAAGAGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007862.2-2966s1c1
Sequence:CCGGGCAGGAGTTCACTGAGCATTTCTCGAGAAATGCTCAGTGAACTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007862.2-2496s1c1
Sequence:CCGGCCAGTGAATCAACAAGAAGTTCTCGAGAACTTCTTGTTGATTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007862.2-2729s1c1
Sequence:CCGGCCAGTATAACAACCATCTGTACTCGAGTACAGATGGTTGTTATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007862.2-958s1c1
Sequence:CCGGGCACTGATGCAGATTATGAATCTCGAGATTCATAATCTGCATCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007862
VALIDATED
DLG1 MISSION shRNA shRNA Plasmid DNA
discs, large homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007862.2-658s21c1
Sequence:CCGGTACTTCCTCCTGAGCATATTTCTCGAGAAATATGCTCAGGAGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007862.2-3242s21c1
Sequence:CCGGGTTGCATCATCTGTACTATTCCTCGAGGAATAGTACAGATGATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007862.2-1929s21c1
Sequence:CCGGGTCACCATCGTTGCGCAATATCTCGAGATATTGCGCAACGATGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007862.2-2523s21c1
Sequence:CCGGACCCGACCAGTCATCATATTACTCGAGTAATATGATGACTGGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007862.2-442s21c1
Sequence:CCGGGCAACCTCTTTCAGGCTTTAACTCGAGTTAAAGCCTGAAAGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007862.2-442s1c1
Sequence:CCGGGCAACCTCTTTCAGGCTTTAACTCGAGTTAAAGCCTGAAAGAGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007862.2-2966s1c1
Sequence:CCGGGCAGGAGTTCACTGAGCATTTCTCGAGAAATGCTCAGTGAACTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007862.2-2496s1c1
Sequence:CCGGCCAGTGAATCAACAAGAAGTTCTCGAGAACTTCTTGTTGATTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007862.2-2729s1c1
Sequence:CCGGCCAGTATAACAACCATCTGTACTCGAGTACAGATGGTTGTTATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007862.2-958s1c1
Sequence:CCGGGCACTGATGCAGATTATGAATCTCGAGATTCATAATCTGCATCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007862
VALIDATED
DLG1 MISSION shRNA Lentiviral Transduction Particles
discs, large homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007862.2-658s21c1
Sequence:CCGGTACTTCCTCCTGAGCATATTTCTCGAGAAATATGCTCAGGAGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007862.2-3242s21c1
Sequence:CCGGGTTGCATCATCTGTACTATTCCTCGAGGAATAGTACAGATGATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007862.2-1929s21c1
Sequence:CCGGGTCACCATCGTTGCGCAATATCTCGAGATATTGCGCAACGATGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007862.2-2523s21c1
Sequence:CCGGACCCGACCAGTCATCATATTACTCGAGTAATATGATGACTGGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007862.2-442s21c1
Sequence:CCGGGCAACCTCTTTCAGGCTTTAACTCGAGTTAAAGCCTGAAAGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007862.2-442s1c1
Sequence:CCGGGCAACCTCTTTCAGGCTTTAACTCGAGTTAAAGCCTGAAAGAGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007862.2-2966s1c1
Sequence:CCGGGCAGGAGTTCACTGAGCATTTCTCGAGAAATGCTCAGTGAACTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007862.2-2496s1c1
Sequence:CCGGCCAGTGAATCAACAAGAAGTTCTCGAGAACTTCTTGTTGATTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007862.2-2729s1c1
Sequence:CCGGCCAGTATAACAACCATCTGTACTCGAGTACAGATGGTTGTTATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007862.2-958s1c1
Sequence:CCGGGCACTGATGCAGATTATGAATCTCGAGATTCATAATCTGCATCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004087
VALIDATED
DLG1 MISSION shRNA Bacterial Glycerol Stock
discs, large homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004087.2-1307s21c1
Sequence:CCGGGCAGTGAATAACGTATGTTTACTCGAGTAAACATACGTTATTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004087.2-1001s21c1
Sequence:CCGGCGGGTCAATGACTGTATATTACTCGAGTAATATACAGTCATTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004087.2-1403s21c1
Sequence:CCGGCCCACAAGTATGTATATGAATCTCGAGATTCATATACATACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004087.2-834s21c1
Sequence:CCGGGCACAGATGCAGATTATGAATCTCGAGATTCATAATCTGCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004087.1-999s1c1
Sequence:CCGGCGGGTCAATGACTGTATATTACTCGAGTAATATACAGTCATTGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004087.1-1401s1c1
Sequence:CCGGCCCACAAGTATGTATATGAATCTCGAGATTCATATACATACTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004087.1-1305s1c1
Sequence:CCGGGCAGTGAATAACGTATGTTTACTCGAGTAAACATACGTTATTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004087.1-832s1c1
Sequence:CCGGGCACAGATGCAGATTATGAATCTCGAGATTCATAATCTGCATCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004087.1-2418s1c1
Sequence:CCGGCCTATGAAAGACAGGATAAATCTCGAGATTTATCCTGTCTTTCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004087
VALIDATED
DLG1 MISSION shRNA shRNA Plasmid DNA
discs, large homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004087.2-1307s21c1
Sequence:CCGGGCAGTGAATAACGTATGTTTACTCGAGTAAACATACGTTATTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004087.2-1001s21c1
Sequence:CCGGCGGGTCAATGACTGTATATTACTCGAGTAATATACAGTCATTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004087.2-1403s21c1
Sequence:CCGGCCCACAAGTATGTATATGAATCTCGAGATTCATATACATACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004087.2-834s21c1
Sequence:CCGGGCACAGATGCAGATTATGAATCTCGAGATTCATAATCTGCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004087.1-999s1c1
Sequence:CCGGCGGGTCAATGACTGTATATTACTCGAGTAATATACAGTCATTGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004087.1-1401s1c1
Sequence:CCGGCCCACAAGTATGTATATGAATCTCGAGATTCATATACATACTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004087.1-1305s1c1
Sequence:CCGGGCAGTGAATAACGTATGTTTACTCGAGTAAACATACGTTATTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004087.1-832s1c1
Sequence:CCGGGCACAGATGCAGATTATGAATCTCGAGATTCATAATCTGCATCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004087.1-2418s1c1
Sequence:CCGGCCTATGAAAGACAGGATAAATCTCGAGATTTATCCTGTCTTTCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004087
VALIDATED
DLG1 MISSION shRNA Lentiviral Transduction Particles
discs, large homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004087.2-1307s21c1
Sequence:CCGGGCAGTGAATAACGTATGTTTACTCGAGTAAACATACGTTATTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004087.2-1001s21c1
Sequence:CCGGCGGGTCAATGACTGTATATTACTCGAGTAATATACAGTCATTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004087.2-1403s21c1
Sequence:CCGGCCCACAAGTATGTATATGAATCTCGAGATTCATATACATACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004087.2-834s21c1
Sequence:CCGGGCACAGATGCAGATTATGAATCTCGAGATTCATAATCTGCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004087.1-999s1c1
Sequence:CCGGCGGGTCAATGACTGTATATTACTCGAGTAATATACAGTCATTGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004087.1-1401s1c1
Sequence:CCGGCCCACAAGTATGTATATGAATCTCGAGATTCATATACATACTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004087.1-1305s1c1
Sequence:CCGGGCAGTGAATAACGTATGTTTACTCGAGTAAACATACGTTATTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004087.1-832s1c1
Sequence:CCGGGCACAGATGCAGATTATGAATCTCGAGATTCATAATCTGCATCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004087.1-2418s1c1
Sequence:CCGGCCTATGAAAGACAGGATAAATCTCGAGATTTATCCTGTCTTTCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks