EMAIL THIS PAGE TO A FRIEND

DLG2

discs, large homolog 2 (Drosophila)

Synonyms: PPP1R58 PSD-93 PSD93 chapsyn-110
Gene ID:
Human(1740) Summary: This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. The encoded protein forms a heterodimer with a related family member that may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described, but their full-length nature is not known. [provided by RefSeq, Dec 2008]
Mouse(23859) discs, large homolog 2 (Drosophila)
Rat(64053) discs, large homolog 2 (Drosophila)
Zebrafish(497638) discs, large (Drosophila) homolog 2
chicken(419024) discs, large homolog 2 (Drosophila)
domestic cat(101097912) discs, large homolog 2 (Drosophila)
dog(485158) discs, large homolog 2 (Drosophila)
fruit fly(250307) discs large 2
sheep(101104867) discs, large homolog 2 (Drosophila)
domestic guinea pig(100732834) discs, large homolog 2 (Drosophila)
naked mole-rat(101712252) discs, large homolog 2 (Drosophila)
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0081 AQUA Peptide GQEDLILSYEPVT[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001364 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMNC009551 MISSION® Long Non-Coding esiRNA AK046356 targeting mouse mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001364 Rosetta Predictions human pricing
NM_022282 Rosetta Predictions rat pricing
NM_011807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222293 predicted 1203
2 SASI_Hs01_00222294 predicted 1030
3 SASI_Hs01_00222295 predicted 1156
4 SASI_Hs01_00222296 predicted 1996
5 SASI_Hs02_00331711 predicted 898
6 SASI_Hs01_00222298 predicted 2163
7 SASI_Hs02_00331712 predicted 1010
8 SASI_Hs01_00222299 predicted 661
9 SASI_Hs01_00222300 predicted 823
10 SASI_Hs01_00222301 predicted 1963
11 SASI_Hs01_00222297 predicted 2543
12 SASI_Hs01_00222302 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113591 predicted 1179
2 SASI_Rn01_00113592 predicted 1129
3 SASI_Rn01_00113593 predicted 2553
4 SASI_Rn01_00113594 predicted 791
5 SASI_Rn01_00113595 predicted 1003
6 SASI_Rn01_00113597 predicted 1147
7 SASI_Rn01_00113598 predicted 2374
8 SASI_Rn01_00113599 predicted 1260
9 SASI_Rn01_00113600 predicted 434
10 SASI_Rn02_00263095 predicted 2291
11 SASI_Rn01_00113596 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022845 predicted 661
2 SASI_Mm01_00022846 predicted 1071
3 SASI_Mm01_00022848 predicted 2495
4 SASI_Mm01_00022849 predicted 2320
5 SASI_Mm02_00321491 predicted 1092
6 SASI_Mm01_00022851 predicted 465
7 SASI_Mm01_00022852 predicted 1055
8 SASI_Mm02_00321492 predicted 578
9 SASI_Mm02_00321493 predicted 382
10 SASI_Mm02_00321494 predicted 1998
11 SASI_Mm01_00022847 predicted 520
12 SASI_Mm01_00022850 predicted 2026
13 SASI_Mm01_00022853 predicted 868
14 SASI_Mm01_00022854 predicted 515
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001364
DLG2 MISSION shRNA Bacterial Glycerol Stock
discs, large homolog 2 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001364.1-2918s1c1
Sequence:CCGGGAAGAGCATTTAGAAGAACAACTCGAGTTGTTCTTCTAAATGCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001364.1-1325s1c1
Sequence:CCGGCTGTGAACAAACTATGTGATACTCGAGTATCACATAGTTTGTTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001364.1-846s1c1
Sequence:CCGGCGTTGTGGAAATCAAACTGTTCTCGAGAACAGTTTGATTTCCACAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001364.1-2517s1c1
Sequence:CCGGCGGCCAGTACAATGACAATTTCTCGAGAAATTGTCATTGTACTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001364.1-2350s1c1
Sequence:CCGGCGGATCAATGACGACTTGATACTCGAGTATCAAGTCGTCATTGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001364
DLG2 MISSION shRNA shRNA Plasmid DNA
discs, large homolog 2 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001364.1-2918s1c1
Sequence:CCGGGAAGAGCATTTAGAAGAACAACTCGAGTTGTTCTTCTAAATGCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001364.1-1325s1c1
Sequence:CCGGCTGTGAACAAACTATGTGATACTCGAGTATCACATAGTTTGTTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001364.1-846s1c1
Sequence:CCGGCGTTGTGGAAATCAAACTGTTCTCGAGAACAGTTTGATTTCCACAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001364.1-2517s1c1
Sequence:CCGGCGGCCAGTACAATGACAATTTCTCGAGAAATTGTCATTGTACTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001364.1-2350s1c1
Sequence:CCGGCGGATCAATGACGACTTGATACTCGAGTATCAAGTCGTCATTGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001364
DLG2 MISSION shRNA Lentiviral Transduction Particles
discs, large homolog 2 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001364.1-2918s1c1
Sequence:CCGGGAAGAGCATTTAGAAGAACAACTCGAGTTGTTCTTCTAAATGCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001364.1-1325s1c1
Sequence:CCGGCTGTGAACAAACTATGTGATACTCGAGTATCACATAGTTTGTTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001364.1-846s1c1
Sequence:CCGGCGTTGTGGAAATCAAACTGTTCTCGAGAACAGTTTGATTTCCACAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001364.1-2517s1c1
Sequence:CCGGCGGCCAGTACAATGACAATTTCTCGAGAAATTGTCATTGTACTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001364.1-2350s1c1
Sequence:CCGGCGGATCAATGACGACTTGATACTCGAGTATCAAGTCGTCATTGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011807
DLG2 MISSION shRNA Bacterial Glycerol Stock
discs, large homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-1178s1c1
Sequence:CCGGCCAGTCATTCTCAGCACAGTACTCGAGTACTGTGCTGAGAATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-1855s1c1
Sequence:CCGGCCTGGTGTGATTGATTCCAAACTCGAGTTTGGAATCAATCACACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-872s1c1
Sequence:CCGGCGGATATTACTCACTCTTATTCTCGAGAATAAGAGTGAGTAATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-2008s1c1
Sequence:CCGGCCCATGAAGGATCGAATCAATCTCGAGATTGATTCGATCCTTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-28s1c1
Sequence:CCGGCGGACTAACGTAAAGAAGTATCTCGAGATACTTCTTTACGTTAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011807.2-1082s21c1
Sequence:CCGGTTATGGGCCACCGGATATTACCTCGAGGTAATATCCGGTGGCCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011807.2-3179s21c1
Sequence:CCGGTAATTGGTACACTTCGAATTTCTCGAGAAATTCGAAGTGTACCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011807.2-425s21c1
Sequence:CCGGGGCTAGCCCTGCTCCTATAATCTCGAGATTATAGGAGCAGGGCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011807
DLG2 MISSION shRNA shRNA Plasmid DNA
discs, large homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-1178s1c1
Sequence:CCGGCCAGTCATTCTCAGCACAGTACTCGAGTACTGTGCTGAGAATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-1855s1c1
Sequence:CCGGCCTGGTGTGATTGATTCCAAACTCGAGTTTGGAATCAATCACACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-872s1c1
Sequence:CCGGCGGATATTACTCACTCTTATTCTCGAGAATAAGAGTGAGTAATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-2008s1c1
Sequence:CCGGCCCATGAAGGATCGAATCAATCTCGAGATTGATTCGATCCTTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-28s1c1
Sequence:CCGGCGGACTAACGTAAAGAAGTATCTCGAGATACTTCTTTACGTTAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011807.2-1082s21c1
Sequence:CCGGTTATGGGCCACCGGATATTACCTCGAGGTAATATCCGGTGGCCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011807.2-3179s21c1
Sequence:CCGGTAATTGGTACACTTCGAATTTCTCGAGAAATTCGAAGTGTACCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011807.2-425s21c1
Sequence:CCGGGGCTAGCCCTGCTCCTATAATCTCGAGATTATAGGAGCAGGGCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011807
DLG2 MISSION shRNA Lentiviral Transduction Particles
discs, large homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-1178s1c1
Sequence:CCGGCCAGTCATTCTCAGCACAGTACTCGAGTACTGTGCTGAGAATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-1855s1c1
Sequence:CCGGCCTGGTGTGATTGATTCCAAACTCGAGTTTGGAATCAATCACACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-872s1c1
Sequence:CCGGCGGATATTACTCACTCTTATTCTCGAGAATAAGAGTGAGTAATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-2008s1c1
Sequence:CCGGCCCATGAAGGATCGAATCAATCTCGAGATTGATTCGATCCTTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011807.1-28s1c1
Sequence:CCGGCGGACTAACGTAAAGAAGTATCTCGAGATACTTCTTTACGTTAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011807.2-1082s21c1
Sequence:CCGGTTATGGGCCACCGGATATTACCTCGAGGTAATATCCGGTGGCCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011807.2-3179s21c1
Sequence:CCGGTAATTGGTACACTTCGAATTTCTCGAGAAATTCGAAGTGTACCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011807.2-425s21c1
Sequence:CCGGGGCTAGCCCTGCTCCTATAATCTCGAGATTATAGGAGCAGGGCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks