EMAIL THIS PAGE TO A FRIEND

DLG3

discs, large homolog 3 (Drosophila)

81 Gene Product Result for
Synonyms: MRX MRX90 NEDLG SAP102 XLMR
UniProtKB ID: Q92796, B4E0H1, D3DVU5, Q5JUW6, Q5JUW7, Q9ULI8
Gene ID:
Human(1741) Summary: This gene encodes a member of the membrane-associated guanylate kinase protein family. The encoded protein may play a role in clustering of NMDA receptors at excitatory synapses. It may also negatively regulate cell proliferation through interaction with the C-terminal region of the adenomatosis polyposis coli tumor suppressor protein. Mutations in this gene have been associated with X-linked mental retardation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2009]
Mouse(53310) discs, large homolog 3 (Drosophila)
Rat(58948) discs, large homolog 3 (Drosophila)
Zebrafish(564081) discs, large homolog 3 (Drosophila)
cow(509882) discs, large homolog 3 (Drosophila)
domestic cat(101088910) discs, large homolog 3 (Drosophila)
dog(491942) discs, large homolog 3 (Drosophila)
chicken(428706) discs, large homolog 3 (Drosophila)
naked mole-rat(101708098) discs, large homolog 3 (Drosophila)
domestic guinea pig(100732206) discs, large homolog 3 (Drosophila)
sheep(101102123) discs, large homolog 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408948 Anti-DLG3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA001733 Anti-DLG3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2100590 Anti-DLG3 antibody produced in rabbit affinity isolated antibody pig, horse, human, rabbit, bovine, mouse, zebrafish, guinea pig, rat
western blot pricing
SAB2100591 Anti-DLG3 antibody produced in rabbit affinity isolated antibody mouse, rat, horse, canine, bovine, guinea pig, rabbit, zebrafish, human
western blot pricing
SAB2106643 Anti-DLG3 antibody produced in rabbit affinity isolated antibody rat, guinea pig, human, rabbit
ELISA, western blot pricing
HPA078130 Anti-DLG3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
S4687 Anti-SAP-102 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat
immunohistochemistry, western blot pricing
WH0001741M3 Monoclonal Anti-DLG3 antibody produced in mouse clone 2B6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5200005 Monoclonal Anti-DLG3 antibody produced in mouse clone S19-2, 1 mg/mL, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016747 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016747 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016747 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021120 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020730 Rosetta Predictions human pricing
NM_021120 Rosetta Predictions human pricing
NM_031639 Rosetta Predictions rat pricing
NM_016747 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353800 predicted 824
2 SASI_Hs02_00353801 predicted 800
3 SASI_Hs02_00353802 predicted 1723
4 SASI_Hs02_00353803 predicted 1662
5 SASI_Hs02_00353804 predicted 706
6 SASI_Hs02_00353805 predicted 1558
7 SASI_Hs02_00353806 predicted 1472
8 SASI_Hs02_00353807 predicted 1674
9 SASI_Hs02_00353808 predicted 1742
10 SASI_Hs02_00353809 predicted 1647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170819 predicted 1850
2 SASI_Hs01_00170821 predicted 1828
3 SASI_Hs01_00170825 predicted 2658
4 SASI_Hs02_00354629 predicted 2594
5 SASI_Hs02_00354630 predicted 1733
6 SASI_Hs02_00354631 predicted 2489
7 SASI_Hs01_00170828 predicted 2406
8 SASI_Hs02_00354632 predicted 2612
9 SASI_Hs02_00354633 predicted 2670
10 SASI_Hs02_00354634 predicted 2575
11 SASI_Hs01_00170820 predicted 1205
12 SASI_Hs01_00170822 predicted 1548
13 SASI_Hs01_00170823 predicted 2153
14 SASI_Hs01_00170824 predicted 1143
15 SASI_Hs01_00170826 predicted 605
16 SASI_Hs01_00170827 predicted 2134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042847 predicted 2177
2 SASI_Rn01_00042848 predicted 1981
3 SASI_Rn01_00042849 predicted 2746
4 SASI_Rn01_00042850 predicted 1392
5 SASI_Rn01_00042851 predicted 2675
6 SASI_Rn01_00042853 predicted 1973
7 SASI_Rn01_00042854 predicted 2333
8 SASI_Rn02_00264946 predicted 853
9 SASI_Rn01_00042855 predicted 1773
10 SASI_Rn01_00042856 predicted 1684
11 SASI_Rn01_00042852 predicted 1897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323477 predicted 2301
2 SASI_Mm01_00105882 predicted 1343
3 SASI_Mm01_00105883 predicted 2155
4 SASI_Mm01_00105884 predicted 2726
5 SASI_Mm01_00105885 predicted 2690
6 SASI_Mm01_00105886 predicted 1874
7 SASI_Mm01_00105887 predicted 2503
8 SASI_Mm01_00105888 predicted 839
9 SASI_Mm02_00323478 predicted 1390
10 SASI_Mm01_00105890 predicted 1882
11 SASI_Mm01_00105889 predicted 1674
12 SASI_Mm01_00105891 predicted 2773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016747
DLG3 MISSION shRNA Bacterial Glycerol Stock
discs, large homolog 3 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016747.2-1667s21c1
Sequence:CCGGGACCGGATCTTATCGGTAAATCTCGAGATTTACCGATAAGATCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016747.2-2161s21c1
Sequence:CCGGTGGGTTAAGTGACGATTATTACTCGAGTAATAATCGTCACTTAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016747.2-1968s21c1
Sequence:CCGGGTGACATTCTGCACGTCATTACTCGAGTAATGACGTGCAGAATGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-2654s1c1
Sequence:CCGGCCAAGTCCATTGAAGCACTTACTCGAGTAAGTGCTTCAATGGACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-1531s1c1
Sequence:CCGGCGCAAGATCATCCTGCACAAACTCGAGTTTGTGCAGGATGATCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-2455s1c1
Sequence:CCGGCGGGAACAAATGGAGAAGGATCTCGAGATCCTTCTCCATTTGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-1468s1c1
Sequence:CCGGCCTACTCGTTACTCTCCTATTCTCGAGAATAGGAGAGTAACGAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-2157s1c1
Sequence:CCGGCCCTGGGTTAAGTGACGATTACTCGAGTAATCGTCACTTAACCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016747
DLG3 MISSION shRNA shRNA Plasmid DNA
discs, large homolog 3 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016747.2-1667s21c1
Sequence:CCGGGACCGGATCTTATCGGTAAATCTCGAGATTTACCGATAAGATCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016747.2-2161s21c1
Sequence:CCGGTGGGTTAAGTGACGATTATTACTCGAGTAATAATCGTCACTTAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016747.2-1968s21c1
Sequence:CCGGGTGACATTCTGCACGTCATTACTCGAGTAATGACGTGCAGAATGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-2654s1c1
Sequence:CCGGCCAAGTCCATTGAAGCACTTACTCGAGTAAGTGCTTCAATGGACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-1531s1c1
Sequence:CCGGCGCAAGATCATCCTGCACAAACTCGAGTTTGTGCAGGATGATCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-2455s1c1
Sequence:CCGGCGGGAACAAATGGAGAAGGATCTCGAGATCCTTCTCCATTTGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-1468s1c1
Sequence:CCGGCCTACTCGTTACTCTCCTATTCTCGAGAATAGGAGAGTAACGAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-2157s1c1
Sequence:CCGGCCCTGGGTTAAGTGACGATTACTCGAGTAATCGTCACTTAACCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016747
DLG3 MISSION shRNA Lentiviral Transduction Particles
discs, large homolog 3 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016747.2-1667s21c1
Sequence:CCGGGACCGGATCTTATCGGTAAATCTCGAGATTTACCGATAAGATCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016747.2-2161s21c1
Sequence:CCGGTGGGTTAAGTGACGATTATTACTCGAGTAATAATCGTCACTTAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016747.2-1968s21c1
Sequence:CCGGGTGACATTCTGCACGTCATTACTCGAGTAATGACGTGCAGAATGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-2654s1c1
Sequence:CCGGCCAAGTCCATTGAAGCACTTACTCGAGTAAGTGCTTCAATGGACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-1531s1c1
Sequence:CCGGCGCAAGATCATCCTGCACAAACTCGAGTTTGTGCAGGATGATCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-2455s1c1
Sequence:CCGGCGGGAACAAATGGAGAAGGATCTCGAGATCCTTCTCCATTTGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-1468s1c1
Sequence:CCGGCCTACTCGTTACTCTCCTATTCTCGAGAATAGGAGAGTAACGAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016747.1-2157s1c1
Sequence:CCGGCCCTGGGTTAAGTGACGATTACTCGAGTAATCGTCACTTAACCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021120
VALIDATED
DLG3 MISSION shRNA Bacterial Glycerol Stock
discs, large homolog 3 (Drosophila)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021120.2-2663s21c1
Sequence:CCGGGAGTACTTTACAGCCATTGTACTCGAGTACAATGGCTGTAAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021120.2-2690s21c1
Sequence:CCGGGACTCACTGGAAGAGATTTATCTCGAGATAAATCTCTTCCAGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.2-3249s1c1
Sequence:CCGGTGGCGACAGAAAGTATCTTATCTCGAGATAAGATACTTTCTGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.2-1227s1c1
Sequence:CCGGACACATCTGATATGGTGTATTCTCGAGAATACACCATATCAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021120.2-3150s21c1
Sequence:CCGGGGCTTGTGAAGTGAGCTAAATCTCGAGATTTAGCTCACTTCACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021120.2-2231s21c1
Sequence:CCGGCCAATGAAGGACCGAGTCAATCTCGAGATTGACTCGGTCCTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021120.2-1481s21c1
Sequence:CCGGCGCAAGATCATCCTGCACAAACTCGAGTTTGTGCAGGATGATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.1-2568s1c1
Sequence:CCGGGAGTACTTTACAGCCATTGTACTCGAGTACAATGGCTGTAAAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021120.1-2595s1c1
Sequence:CCGGGACTCACTGGAAGAGATTTATCTCGAGATAAATCTCTTCCAGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_021120.1-1386s1c1
Sequence:CCGGCGCAAGATCATCCTGCACAAACTCGAGTTTGTGCAGGATGATCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021120.1-2147s1c1
Sequence:CCGGCCGAGTCAATGATGACCTGATCTCGAGATCAGGTCATCATTGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021120.1-2220s1c1
Sequence:CCGGCGACGTGATAATGAGGTGGATCTCGAGATCCACCTCATTATCACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.1-2903s1c1
Sequence:CCGGCATCATGTGACTGTGCCCATTCTCGAGAATGGGCACAGTCACATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.1-2467s1c1
Sequence:CCGGCCAAGTCCATTGAAGCCCTTACTCGAGTAAGGGCTTCAATGGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021120.1-2136s1c1
Sequence:CCGGCCAATGAAGGACCGAGTCAATCTCGAGATTGACTCGGTCCTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021120
VALIDATED
DLG3 MISSION shRNA shRNA Plasmid DNA
discs, large homolog 3 (Drosophila)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021120.2-2663s21c1
Sequence:CCGGGAGTACTTTACAGCCATTGTACTCGAGTACAATGGCTGTAAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021120.2-2690s21c1
Sequence:CCGGGACTCACTGGAAGAGATTTATCTCGAGATAAATCTCTTCCAGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.2-3249s1c1
Sequence:CCGGTGGCGACAGAAAGTATCTTATCTCGAGATAAGATACTTTCTGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.2-1227s1c1
Sequence:CCGGACACATCTGATATGGTGTATTCTCGAGAATACACCATATCAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021120.2-3150s21c1
Sequence:CCGGGGCTTGTGAAGTGAGCTAAATCTCGAGATTTAGCTCACTTCACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021120.2-2231s21c1
Sequence:CCGGCCAATGAAGGACCGAGTCAATCTCGAGATTGACTCGGTCCTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021120.2-1481s21c1
Sequence:CCGGCGCAAGATCATCCTGCACAAACTCGAGTTTGTGCAGGATGATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.1-2568s1c1
Sequence:CCGGGAGTACTTTACAGCCATTGTACTCGAGTACAATGGCTGTAAAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021120.1-2595s1c1
Sequence:CCGGGACTCACTGGAAGAGATTTATCTCGAGATAAATCTCTTCCAGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_021120.1-1386s1c1
Sequence:CCGGCGCAAGATCATCCTGCACAAACTCGAGTTTGTGCAGGATGATCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021120.1-2147s1c1
Sequence:CCGGCCGAGTCAATGATGACCTGATCTCGAGATCAGGTCATCATTGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021120.1-2220s1c1
Sequence:CCGGCGACGTGATAATGAGGTGGATCTCGAGATCCACCTCATTATCACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.1-2903s1c1
Sequence:CCGGCATCATGTGACTGTGCCCATTCTCGAGAATGGGCACAGTCACATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.1-2467s1c1
Sequence:CCGGCCAAGTCCATTGAAGCCCTTACTCGAGTAAGGGCTTCAATGGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021120.1-2136s1c1
Sequence:CCGGCCAATGAAGGACCGAGTCAATCTCGAGATTGACTCGGTCCTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021120
VALIDATED
DLG3 MISSION shRNA Lentiviral Transduction Particles
discs, large homolog 3 (Drosophila)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021120.2-2663s21c1
Sequence:CCGGGAGTACTTTACAGCCATTGTACTCGAGTACAATGGCTGTAAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021120.2-2690s21c1
Sequence:CCGGGACTCACTGGAAGAGATTTATCTCGAGATAAATCTCTTCCAGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.2-3249s1c1
Sequence:CCGGTGGCGACAGAAAGTATCTTATCTCGAGATAAGATACTTTCTGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.2-1227s1c1
Sequence:CCGGACACATCTGATATGGTGTATTCTCGAGAATACACCATATCAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021120.2-3150s21c1
Sequence:CCGGGGCTTGTGAAGTGAGCTAAATCTCGAGATTTAGCTCACTTCACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021120.2-2231s21c1
Sequence:CCGGCCAATGAAGGACCGAGTCAATCTCGAGATTGACTCGGTCCTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021120.2-1481s21c1
Sequence:CCGGCGCAAGATCATCCTGCACAAACTCGAGTTTGTGCAGGATGATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.1-2568s1c1
Sequence:CCGGGAGTACTTTACAGCCATTGTACTCGAGTACAATGGCTGTAAAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021120.1-2595s1c1
Sequence:CCGGGACTCACTGGAAGAGATTTATCTCGAGATAAATCTCTTCCAGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_021120.1-1386s1c1
Sequence:CCGGCGCAAGATCATCCTGCACAAACTCGAGTTTGTGCAGGATGATCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021120.1-2147s1c1
Sequence:CCGGCCGAGTCAATGATGACCTGATCTCGAGATCAGGTCATCATTGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021120.1-2220s1c1
Sequence:CCGGCGACGTGATAATGAGGTGGATCTCGAGATCCACCTCATTATCACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.1-2903s1c1
Sequence:CCGGCATCATGTGACTGTGCCCATTCTCGAGAATGGGCACAGTCACATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021120.1-2467s1c1
Sequence:CCGGCCAAGTCCATTGAAGCCCTTACTCGAGTAAGGGCTTCAATGGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021120.1-2136s1c1
Sequence:CCGGCCAATGAAGGACCGAGTCAATCTCGAGATTGACTCGGTCCTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks