EMAIL THIS PAGE TO A FRIEND

DLG4

discs, large homolog 4 (Drosophila)

Synonyms: PSD95 SAP-90 SAP90
UniProtKB ID: P78352, B7Z1S1, G5E939, Q92941, Q9UKK8
Gene ID:
Human(1742) Summary: This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. It heteromultimerizes with another MAGUK protein, DLG2, and is recruited into NMDA receptor and potassium channel clusters. These two MAGUK proteins may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(13385) discs, large homolog 4 (Drosophila)
Rat(29495) discs, large homolog 4 (Drosophila)
Zebrafish(405796) discs, large (Drosophila) homolog 4
Zebrafish(100000823) discs, large homolog 4 (Drosophila)
domestic cat(101093902) discs, large homolog 4 (Drosophila)
cow(100137840) discs, large homolog 4 (Drosophila)
dog(489462) discs, large homolog 4 (Drosophila)
sheep(101116743) discs, large homolog 4 (Drosophila)
domestic guinea pig(100717910) discs, large homolog 4 (Drosophila)
naked mole-rat(101708587) discs, large homolog 4 (Drosophila)
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0088 AQUA Peptide DLLGEEDIP[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001365 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007864 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007864 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007864 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001365 Rosetta Predictions human pricing
NM_019621 Rosetta Predictions rat pricing
NM_001109752 Rosetta Predictions mouse pricing
NM_007864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110920 predicted 1121
2 SASI_Hs01_00110921 predicted 2788
3 SASI_Hs01_00110922 predicted 3103
4 SASI_Hs01_00110923 predicted 1154
5 SASI_Hs01_00110924 predicted 1790
6 SASI_Hs02_00331713 predicted 1640
7 SASI_Hs01_00110926 predicted 2173
8 SASI_Hs01_00110927 predicted 2820
9 SASI_Hs01_00110928 predicted 3058
10 SASI_Hs02_00331714 predicted 2730
11 SASI_Hs01_00110919 predicted 1170
12 SASI_Hs01_00110925 predicted 1696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037828 predicted 757
2 SASI_Rn01_00037829 predicted 200
3 SASI_Rn01_00037830 predicted 196
4 SASI_Rn02_00262433 predicted 470
5 SASI_Rn01_00037831 predicted 1436
6 SASI_Rn02_00262434 predicted 2156
7 SASI_Rn01_00037832 predicted 2141
8 SASI_Rn01_00037833 predicted 676
9 SASI_Rn01_00037834 predicted 861
10 SASI_Rn01_00037835 predicted 233
11 SASI_Rn01_00037836 predicted 1617
12 SASI_Rn01_00037837 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304274 predicted 1933
2 SASI_Mm02_00304275 predicted 852
3 SASI_Mm02_00304276 predicted 2074
4 SASI_Mm02_00304277 predicted 1747
5 SASI_Mm02_00304278 predicted 2262
6 SASI_Mm02_00304279 predicted 930
7 SASI_Mm02_00304280 predicted 2386
8 SASI_Mm02_00304281 predicted 1101
9 SASI_Mm02_00304282 predicted 1862
10 SASI_Mm02_00304283 predicted 1458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040441 predicted 1942
2 SASI_Mm01_00040442 predicted 859
3 SASI_Mm02_00312646 predicted 2088
4 SASI_Mm01_00040444 predicted 1756
5 SASI_Mm02_00312647 predicted 2271
6 SASI_Mm01_00040445 predicted 940
7 SASI_Mm02_00312648 predicted 2398
8 SASI_Mm01_00040446 predicted 1116
9 SASI_Mm01_00040448 predicted 1875
10 SASI_Mm01_00040449 predicted 1473
11 SASI_Mm01_00040440 predicted 766
12 SASI_Mm01_00040443 predicted 207
13 SASI_Mm01_00040447 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001365
VALIDATED
DLG4 MISSION shRNA Bacterial Glycerol Stock
discs, large homolog 4 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001365.1-3752s1c1
Sequence:CCGGGCATGAGTGGAAGGTCTAAATCTCGAGATTTAGACCTTCCACTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001365.1-2144s1c1
Sequence:CCGGGTCACGATCATCGCTCAGTATCTCGAGATACTGAGCGATGATCGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001365.1-2962s1c1
Sequence:CCGGGCTAGAGATTAACAAGCGGATCTCGAGATCCGCTTGTTAATCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001365.1-1003s1c1
Sequence:CCGGCCTCTCAGAGAGTCAGAAATACTCGAGTATTTCTGACTCTCTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001365.1-1692s1c1
Sequence:CCGGCGTATGATGTTGTCTACCTAACTCGAGTTAGGTAGACAACATCATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001365.2-3781s21c1
Sequence:CCGGTGCATGAGTGGAAGGTCTAAACTCGAGTTTAGACCTTCCACTCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001365.2-2177s21c1
Sequence:CCGGACGATCATCGCTCAGTATAAACTCGAGTTTATACTGAGCGATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001365.2-1004s21c1
Sequence:CCGGCTGGACATCCTGGACTATTATCTCGAGATAATAGTCCAGGATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001365.2-1724s21c1
Sequence:CCGGTATGATGTTGTCTACCTAAAGCTCGAGCTTTAGGTAGACAACATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001365
VALIDATED
DLG4 MISSION shRNA shRNA Plasmid DNA
discs, large homolog 4 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001365.1-3752s1c1
Sequence:CCGGGCATGAGTGGAAGGTCTAAATCTCGAGATTTAGACCTTCCACTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001365.1-2144s1c1
Sequence:CCGGGTCACGATCATCGCTCAGTATCTCGAGATACTGAGCGATGATCGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001365.1-2962s1c1
Sequence:CCGGGCTAGAGATTAACAAGCGGATCTCGAGATCCGCTTGTTAATCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001365.1-1003s1c1
Sequence:CCGGCCTCTCAGAGAGTCAGAAATACTCGAGTATTTCTGACTCTCTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001365.1-1692s1c1
Sequence:CCGGCGTATGATGTTGTCTACCTAACTCGAGTTAGGTAGACAACATCATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001365.2-3781s21c1
Sequence:CCGGTGCATGAGTGGAAGGTCTAAACTCGAGTTTAGACCTTCCACTCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001365.2-2177s21c1
Sequence:CCGGACGATCATCGCTCAGTATAAACTCGAGTTTATACTGAGCGATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001365.2-1004s21c1
Sequence:CCGGCTGGACATCCTGGACTATTATCTCGAGATAATAGTCCAGGATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001365.2-1724s21c1
Sequence:CCGGTATGATGTTGTCTACCTAAAGCTCGAGCTTTAGGTAGACAACATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001365
VALIDATED
DLG4 MISSION shRNA Lentiviral Transduction Particles
discs, large homolog 4 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001365.1-3752s1c1
Sequence:CCGGGCATGAGTGGAAGGTCTAAATCTCGAGATTTAGACCTTCCACTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001365.1-2144s1c1
Sequence:CCGGGTCACGATCATCGCTCAGTATCTCGAGATACTGAGCGATGATCGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001365.1-2962s1c1
Sequence:CCGGGCTAGAGATTAACAAGCGGATCTCGAGATCCGCTTGTTAATCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001365.1-1003s1c1
Sequence:CCGGCCTCTCAGAGAGTCAGAAATACTCGAGTATTTCTGACTCTCTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001365.1-1692s1c1
Sequence:CCGGCGTATGATGTTGTCTACCTAACTCGAGTTAGGTAGACAACATCATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001365.2-3781s21c1
Sequence:CCGGTGCATGAGTGGAAGGTCTAAACTCGAGTTTAGACCTTCCACTCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001365.2-2177s21c1
Sequence:CCGGACGATCATCGCTCAGTATAAACTCGAGTTTATACTGAGCGATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001365.2-1004s21c1
Sequence:CCGGCTGGACATCCTGGACTATTATCTCGAGATAATAGTCCAGGATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001365.2-1724s21c1
Sequence:CCGGTATGATGTTGTCTACCTAAAGCTCGAGCTTTAGGTAGACAACATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007864
VALIDATED
DLG4 MISSION shRNA Bacterial Glycerol Stock
discs, large homolog 4 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007864.1-606s1c1
Sequence:CCGGCCCTGGAGATAATAGCATCTACTCGAGTAGATGCTATTATCTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007864.1-2031s1c1
Sequence:CCGGGCTAGAGATCAATAAGCGGATCTCGAGATCCGCTTATTGATCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007864.1-745s1c1
Sequence:CCGGGCAGCCCTGAAGAACACATATCTCGAGATATGTGTTCTTCAGGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007864.1-1756s1c1
Sequence:CCGGACACGTCCTAAGCGGGAATATCTCGAGATATTCCCGCTTAGGACGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007864.1-870s1c1
Sequence:CCGGGATCAGTCATAGCAGCTACTTCTCGAGAAGTAGCTGCTATGACTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007864.3-1803s21c1
Sequence:CCGGACGAGAGTGGTCAAGGTTAAACTCGAGTTTAACCTTGACCACTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007864.3-1089s21c1
Sequence:CCGGAGACATCACAACCTCATATTCCTCGAGGAATATGAGGTTGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007864.3-2947s21c1
Sequence:CCGGCCGTTTGAGTTCTCCTTTATTCTCGAGAATAAAGGAGAACTCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007864.3-2014s21c1
Sequence:CCGGACACGTCCTAAGCGGGAATATCTCGAGATATTCCCGCTTAGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007864.3-1128s21c1
Sequence:CCGGGATCAGTCATAGCAGCTACTTCTCGAGAAGTAGCTGCTATGACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007864
VALIDATED
DLG4 MISSION shRNA shRNA Plasmid DNA
discs, large homolog 4 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007864.1-606s1c1
Sequence:CCGGCCCTGGAGATAATAGCATCTACTCGAGTAGATGCTATTATCTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007864.1-2031s1c1
Sequence:CCGGGCTAGAGATCAATAAGCGGATCTCGAGATCCGCTTATTGATCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007864.1-745s1c1
Sequence:CCGGGCAGCCCTGAAGAACACATATCTCGAGATATGTGTTCTTCAGGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007864.1-1756s1c1
Sequence:CCGGACACGTCCTAAGCGGGAATATCTCGAGATATTCCCGCTTAGGACGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007864.1-870s1c1
Sequence:CCGGGATCAGTCATAGCAGCTACTTCTCGAGAAGTAGCTGCTATGACTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007864.3-1803s21c1
Sequence:CCGGACGAGAGTGGTCAAGGTTAAACTCGAGTTTAACCTTGACCACTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007864.3-1089s21c1
Sequence:CCGGAGACATCACAACCTCATATTCCTCGAGGAATATGAGGTTGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007864.3-2947s21c1
Sequence:CCGGCCGTTTGAGTTCTCCTTTATTCTCGAGAATAAAGGAGAACTCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007864.3-2014s21c1
Sequence:CCGGACACGTCCTAAGCGGGAATATCTCGAGATATTCCCGCTTAGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007864.3-1128s21c1
Sequence:CCGGGATCAGTCATAGCAGCTACTTCTCGAGAAGTAGCTGCTATGACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007864
VALIDATED
DLG4 MISSION shRNA Lentiviral Transduction Particles
discs, large homolog 4 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007864.1-606s1c1
Sequence:CCGGCCCTGGAGATAATAGCATCTACTCGAGTAGATGCTATTATCTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007864.1-2031s1c1
Sequence:CCGGGCTAGAGATCAATAAGCGGATCTCGAGATCCGCTTATTGATCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007864.1-745s1c1
Sequence:CCGGGCAGCCCTGAAGAACACATATCTCGAGATATGTGTTCTTCAGGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007864.1-1756s1c1
Sequence:CCGGACACGTCCTAAGCGGGAATATCTCGAGATATTCCCGCTTAGGACGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007864.1-870s1c1
Sequence:CCGGGATCAGTCATAGCAGCTACTTCTCGAGAAGTAGCTGCTATGACTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007864.3-1803s21c1
Sequence:CCGGACGAGAGTGGTCAAGGTTAAACTCGAGTTTAACCTTGACCACTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007864.3-1089s21c1
Sequence:CCGGAGACATCACAACCTCATATTCCTCGAGGAATATGAGGTTGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007864.3-2947s21c1
Sequence:CCGGCCGTTTGAGTTCTCCTTTATTCTCGAGAATAAAGGAGAACTCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007864.3-2014s21c1
Sequence:CCGGACACGTCCTAAGCGGGAATATCTCGAGATATTCCCGCTTAGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007864.3-1128s21c1
Sequence:CCGGGATCAGTCATAGCAGCTACTTCTCGAGAAGTAGCTGCTATGACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks