EMAIL THIS PAGE TO A FRIEND

DLG5

discs, large homolog 5 (Drosophila)

113 Gene Product Result for
Synonyms: LP-DLG P-DLG5 PDLG
Gene ID:
Human(9231) Summary: This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(71228) discs, large homolog 5 (Drosophila)
Rat(305645) discs, large homolog 5 (Drosophila)
naked mole-rat(101705010) discs, large homolog 5 (Drosophila)
domestic guinea pig(100728627) discs, large homolog 5 (Drosophila)
sheep(101110731) discs, large homolog 5 (Drosophila)
chicken(423728) discs, large homolog 5 (Drosophila)
cow(535699) discs, large homolog 5 (Drosophila)
Horse(100072996) discs, large homolog 5 (Drosophila)
domestic cat(101093803) discs, large homolog 5 (Drosophila)
dog(489061) discs, large homolog 5 (Drosophila)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027726 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027726 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027726 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004747 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004747 Rosetta Predictions human pricing
NM_001107247 Rosetta Predictions rat pricing
XM_907765 Rosetta Predictions mouse pricing
XM_977694 Rosetta Predictions mouse pricing
XM_981375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105037 predicted 5516
2 SASI_Hs02_00338230 predicted 2250
3 SASI_Hs01_00105039 predicted 3863
4 SASI_Hs01_00105040 predicted 2376
5 SASI_Hs01_00105041 predicted 929
6 SASI_Hs01_00105042 predicted 5247
7 SASI_Hs02_00338231 predicted 4172
8 SASI_Hs01_00105043 predicted 2576
9 SASI_Hs01_00105045 predicted 5899
10 SASI_Hs01_00105046 predicted 5668
11 SASI_Hs01_00105038 predicted 5767
12 SASI_Hs01_00105044 predicted 2000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226955 predicted 1646
2 SASI_Rn02_00226956 predicted 1767
3 SASI_Rn02_00226957 predicted 1615
4 SASI_Rn02_00226958 predicted 2192
5 SASI_Rn02_00226959 predicted 3503
6 SASI_Rn02_00226960 predicted 1396
7 SASI_Rn02_00226961 predicted 2976
8 SASI_Rn02_00226962 predicted 3811
9 SASI_Rn02_00226963 predicted 2602
10 SASI_Rn02_00226964 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283104 predicted 5345
2 SASI_Mm01_00283105 predicted 6290
3 SASI_Mm01_00283106 predicted 6366
4 SASI_Mm01_00283107 predicted 6277
5 SASI_Mm01_00283108 predicted 6218
6 SASI_Mm01_00283109 predicted 5317
7 SASI_Mm01_00283110 predicted 6091
8 SASI_Mm01_00283111 predicted 6179
9 SASI_Mm01_00283112 predicted 6317
10 SASI_Mm01_00283113 predicted 6218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202872 predicted 5673
2 SASI_Mm01_00202873 predicted 6623
3 SASI_Mm01_00202874 predicted 6704
4 SASI_Mm01_00202875 predicted 6613
5 SASI_Mm01_00202876 predicted 6551
6 SASI_Mm01_00202877 predicted 5648
7 SASI_Mm01_00202878 predicted 6414
8 SASI_Mm01_00202879 predicted 6513
9 SASI_Mm01_00202880 predicted 6653
10 SASI_Mm01_00202881 predicted 6549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447570 predicted 4181
2 SASI_Mm02_00447571 predicted 5163
3 SASI_Mm02_00447572 predicted 3635
4 SASI_Mm02_00447573 predicted 2659
5 SASI_Mm02_00447574 predicted 4169
6 SASI_Mm02_00447575 predicted 5598
7 SASI_Mm02_00447576 predicted 5989
8 SASI_Mm02_00447577 predicted 2866
9 SASI_Mm02_00447578 predicted 3683
10 SASI_Mm02_00447579 predicted 4515
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027726
DLG5 MISSION shRNA Bacterial Glycerol Stock
discs, large homolog 5 (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000339145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027726.1-2389s21c1
Sequence:CCGGGCATTGCTGATGGTCGCTTAACTCGAGTTAAGCGACCATCAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027726.1-2703s21c1
Sequence:CCGGGCACTGGACAATAAGTCTCTACTCGAGTAGAGACTTATTGTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027726.1-3273s21c1
Sequence:CCGGCCTGAGAAACTCTCTGTGTATCTCGAGATACACAGAGAGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027726.1-5646s21c1
Sequence:CCGGCCTTTACTGGATGTGGTGAAACTCGAGTTTCACCACATCCAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027726
DLG5 MISSION shRNA shRNA Plasmid DNA
discs, large homolog 5 (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000339145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027726.1-2389s21c1
Sequence:CCGGGCATTGCTGATGGTCGCTTAACTCGAGTTAAGCGACCATCAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027726.1-2703s21c1
Sequence:CCGGGCACTGGACAATAAGTCTCTACTCGAGTAGAGACTTATTGTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027726.1-3273s21c1
Sequence:CCGGCCTGAGAAACTCTCTGTGTATCTCGAGATACACAGAGAGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027726.1-5646s21c1
Sequence:CCGGCCTTTACTGGATGTGGTGAAACTCGAGTTTCACCACATCCAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027726
DLG5 MISSION shRNA Lentiviral Transduction Particles
discs, large homolog 5 (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000339145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027726.1-2389s21c1
Sequence:CCGGGCATTGCTGATGGTCGCTTAACTCGAGTTAAGCGACCATCAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027726.1-2703s21c1
Sequence:CCGGGCACTGGACAATAAGTCTCTACTCGAGTAGAGACTTATTGTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027726.1-3273s21c1
Sequence:CCGGCCTGAGAAACTCTCTGTGTATCTCGAGATACACAGAGAGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027726.1-5646s21c1
Sequence:CCGGCCTTTACTGGATGTGGTGAAACTCGAGTTTCACCACATCCAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004747
DLG5 MISSION shRNA Bacterial Glycerol Stock
discs, large homolog 5 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004747.2-6318s1c1
Sequence:CCGGGCAGGGTAATTCTTAAACTTTCTCGAGAAAGTTTAAGAATTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004747.2-3942s1c1
Sequence:CCGGGCAGTGTGATACCATCACCATCTCGAGATGGTGATGGTATCACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004747.2-3474s1c1
Sequence:CCGGCCTGGGTTCTTCGAGTAACTTCTCGAGAAGTTACTCGAAGAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004747.2-2175s1c1
Sequence:CCGGCCAGGCTCATAACAAACGGAACTCGAGTTCCGTTTGTTATGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004747.2-4686s1c1
Sequence:CCGGGCTCAGCATGTCTGAAGTCAACTCGAGTTGACTTCAGACATGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004747
DLG5 MISSION shRNA shRNA Plasmid DNA
discs, large homolog 5 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004747.2-6318s1c1
Sequence:CCGGGCAGGGTAATTCTTAAACTTTCTCGAGAAAGTTTAAGAATTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004747.2-3942s1c1
Sequence:CCGGGCAGTGTGATACCATCACCATCTCGAGATGGTGATGGTATCACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004747.2-3474s1c1
Sequence:CCGGCCTGGGTTCTTCGAGTAACTTCTCGAGAAGTTACTCGAAGAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004747.2-2175s1c1
Sequence:CCGGCCAGGCTCATAACAAACGGAACTCGAGTTCCGTTTGTTATGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004747.2-4686s1c1
Sequence:CCGGGCTCAGCATGTCTGAAGTCAACTCGAGTTGACTTCAGACATGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004747
DLG5 MISSION shRNA Lentiviral Transduction Particles
discs, large homolog 5 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004747.2-6318s1c1
Sequence:CCGGGCAGGGTAATTCTTAAACTTTCTCGAGAAAGTTTAAGAATTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004747.2-3942s1c1
Sequence:CCGGGCAGTGTGATACCATCACCATCTCGAGATGGTGATGGTATCACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004747.2-3474s1c1
Sequence:CCGGCCTGGGTTCTTCGAGTAACTTCTCGAGAAGTTACTCGAAGAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004747.2-2175s1c1
Sequence:CCGGCCAGGCTCATAACAAACGGAACTCGAGTTCCGTTTGTTATGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004747.2-4686s1c1
Sequence:CCGGGCTCAGCATGTCTGAAGTCAACTCGAGTTGACTTCAGACATGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks