EMAIL THIS PAGE TO A FRIEND

DLGAP1

discs, large (Drosophila) homolog-associated protein 1

146 Gene Product Result for
Synonyms: DAP-1 DAP-1-ALPHA DAP-1-BETA GKAP SAPAP1 hGKAP
Gene ID:
Mouse(224997) discs, large (Drosophila) homolog-associated protein 1
Rat(65040) discs, large (Drosophila) homolog-associated protein 1
Zebrafish(571372) discs, large (Drosophila) homolog-associated protein 1
chicken(428520) discs, large (Drosophila) homolog-associated protein 1
domestic cat(101084321) discs, large (Drosophila) homolog-associated protein 1
cow(526435) discs, large (Drosophila) homolog-associated protein 1
Horse(100051510) discs, large (Drosophila) homolog-associated protein 1
dog(480194) discs, large (Drosophila) homolog-associated protein 1
sheep(101105792) discs, large (Drosophila) homolog-associated protein 1
Domestic Rabbit(100342375) discs, large (Drosophila) homolog-associated protein 1
domestic guinea pig(100720318) discs, large (Drosophila) homolog-associated protein 1
naked mole-rat(101699584) discs, large (Drosophila) homolog-associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001003809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003809 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003809 Rosetta Predictions human pricing
NM_004746 Rosetta Predictions human pricing
NM_022946 Rosetta Predictions rat pricing
NM_001128180 Rosetta Predictions mouse pricing
NM_001128181 Rosetta Predictions mouse pricing
NM_027712 Rosetta Predictions mouse pricing
NM_177639 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036516 predicted 1644
2 SASI_Hs01_00036517 predicted 754
3 SASI_Hs01_00036518 predicted 1331
4 SASI_Hs02_00304398 predicted 1226
5 SASI_Hs01_00036520 predicted 1803
6 SASI_Hs01_00036521 predicted 1763
7 SASI_Hs01_00036522 predicted 585
8 SASI_Hs01_00036523 predicted 1678
9 SASI_Hs01_00036525 predicted 705
10 SASI_Hs02_00304399 predicted 1419
11 SASI_Hs01_00036519 predicted 294
12 SASI_Hs01_00036524 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139313 predicted 2590
2 SASI_Hs01_00139314 predicted 1700
3 SASI_Hs01_00139315 predicted 2282
4 SASI_Hs02_00338228 predicted 2172
5 SASI_Hs01_00139317 predicted 2757
6 SASI_Hs01_00139318 predicted 2723
7 SASI_Hs01_00139319 predicted 1536
8 SASI_Hs01_00139320 predicted 2628
9 SASI_Hs01_00139322 predicted 1665
10 SASI_Hs02_00338229 predicted 2377
11 SASI_Hs01_00139316 predicted 1250
12 SASI_Hs01_00139321 predicted 2385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022946 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263674 predicted 2844
2 SASI_Rn01_00077526 predicted 2474
3 SASI_Rn01_00077527 predicted 1519
4 SASI_Rn01_00077528 predicted 1045
5 SASI_Rn01_00077529 predicted 3012
6 SASI_Rn01_00077530 predicted 406
7 SASI_Rn01_00077531 predicted 1909
8 SASI_Rn01_00077532 predicted 1896
9 SASI_Rn01_00077533 predicted 1515
10 SASI_Rn01_00077534 predicted 2454
11 SASI_Rn01_00077525 predicted 1968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310618 predicted 355
2 SASI_Mm02_00310619 predicted 1415
3 SASI_Mm02_00310620 predicted 1647
4 SASI_Mm02_00310621 predicted 519
5 SASI_Mm02_00310622 predicted 416
6 SASI_Mm02_00310623 predicted 1610
7 SASI_Mm02_00310624 predicted 356
8 SASI_Mm02_00310625 predicted 419
9 SASI_Mm02_00310626 predicted 1505
10 SASI_Mm02_00310627 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310628 predicted 324
2 SASI_Mm02_00310629 predicted 1417
3 SASI_Mm02_00310630 predicted 1654
4 SASI_Mm02_00310631 predicted 491
5 SASI_Mm02_00310632 predicted 395
6 SASI_Mm02_00310633 predicted 1609
7 SASI_Mm02_00310634 predicted 330
8 SASI_Mm02_00310635 predicted 393
9 SASI_Mm02_00310636 predicted 1502
10 SASI_Mm02_00310637 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332631 predicted 1342
2 SASI_Mm02_00332632 predicted 2397
3 SASI_Mm02_00332633 predicted 2635
4 SASI_Mm02_00332634 predicted 1505
5 SASI_Mm02_00332635 predicted 1405
6 SASI_Mm02_00332636 predicted 2598
7 SASI_Mm02_00332637 predicted 1339
8 SASI_Mm02_00332638 predicted 1413
9 SASI_Mm01_00030187 predicted 2490
10 SASI_Mm02_00332639 predicted 1408
11 SASI_Mm01_00030180 predicted 2488
12 SASI_Mm01_00030181 predicted 785
13 SASI_Mm01_00030182 predicted 2655
14 SASI_Mm01_00030183 predicted 898
15 SASI_Mm01_00030184 predicted 524
16 SASI_Mm01_00030185 predicted 441
17 SASI_Mm01_00030186 predicted 2637
18 SASI_Mm01_00030188 predicted 2428
19 SASI_Mm01_00030189 predicted 2107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347882 predicted 1345
2 SASI_Mm02_00347883 predicted 2428
3 SASI_Mm02_00347884 predicted 2666
4 SASI_Mm02_00347885 predicted 1506
5 SASI_Mm02_00347886 predicted 1411
6 SASI_Mm02_00347887 predicted 2624
7 SASI_Mm02_00347888 predicted 1344
8 SASI_Mm02_00347889 predicted 1407
9 SASI_Mm01_00034981 predicted 2520
10 SASI_Mm02_00347890 predicted 1401
11 SASI_Mm01_00034974 predicted 2738
12 SASI_Mm01_00034975 predicted 954
13 SASI_Mm01_00034976 predicted 2910
14 SASI_Mm01_00034977 predicted 1060
15 SASI_Mm01_00034978 predicted 684
16 SASI_Mm01_00034979 predicted 609
17 SASI_Mm01_00034980 predicted 2884
18 SASI_Mm01_00034982 predicted 2679
19 SASI_Mm01_00034983 predicted 2349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027712
DLGAP1 MISSION shRNA Bacterial Glycerol Stock
discs, large (Drosophila) homolog-associated protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-771s1c1
Sequence:CCGGCCGGAGTAACAATGACATCAACTCGAGTTGATGTCATTGTTACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-2067s1c1
Sequence:CCGGCGACCTGGACTTCCATGATAACTCGAGTTATCATGGAAGTCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-880s1c1
Sequence:CCGGGCCCGAGAGGTTTATCAGAAACTCGAGTTTCTGATAAACCTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-2592s1c1
Sequence:CCGGGCAGTTGTCCATAGAGAATATCTCGAGATATTCTCTATGGACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-513s1c1
Sequence:CCGGCGAGTCGCAAACTCTGAGATACTCGAGTATCTCAGAGTTTGCGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027712.3-3076s21c1
Sequence:CCGGTAATGTGTCTCAGGCATATTTCTCGAGAAATATGCCTGAGACACATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027712.3-2442s21c1
Sequence:CCGGTGACGACTTTGACACGGATTTCTCGAGAAATCCGTGTCAAAGTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027712
DLGAP1 MISSION shRNA shRNA Plasmid DNA
discs, large (Drosophila) homolog-associated protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-771s1c1
Sequence:CCGGCCGGAGTAACAATGACATCAACTCGAGTTGATGTCATTGTTACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-2067s1c1
Sequence:CCGGCGACCTGGACTTCCATGATAACTCGAGTTATCATGGAAGTCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-880s1c1
Sequence:CCGGGCCCGAGAGGTTTATCAGAAACTCGAGTTTCTGATAAACCTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-2592s1c1
Sequence:CCGGGCAGTTGTCCATAGAGAATATCTCGAGATATTCTCTATGGACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-513s1c1
Sequence:CCGGCGAGTCGCAAACTCTGAGATACTCGAGTATCTCAGAGTTTGCGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027712.3-3076s21c1
Sequence:CCGGTAATGTGTCTCAGGCATATTTCTCGAGAAATATGCCTGAGACACATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027712.3-2442s21c1
Sequence:CCGGTGACGACTTTGACACGGATTTCTCGAGAAATCCGTGTCAAAGTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027712
DLGAP1 MISSION shRNA Lentiviral Transduction Particles
discs, large (Drosophila) homolog-associated protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-771s1c1
Sequence:CCGGCCGGAGTAACAATGACATCAACTCGAGTTGATGTCATTGTTACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-2067s1c1
Sequence:CCGGCGACCTGGACTTCCATGATAACTCGAGTTATCATGGAAGTCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-880s1c1
Sequence:CCGGGCCCGAGAGGTTTATCAGAAACTCGAGTTTCTGATAAACCTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-2592s1c1
Sequence:CCGGGCAGTTGTCCATAGAGAATATCTCGAGATATTCTCTATGGACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027712.2-513s1c1
Sequence:CCGGCGAGTCGCAAACTCTGAGATACTCGAGTATCTCAGAGTTTGCGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027712.3-3076s21c1
Sequence:CCGGTAATGTGTCTCAGGCATATTTCTCGAGAAATATGCCTGAGACACATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027712.3-2442s21c1
Sequence:CCGGTGACGACTTTGACACGGATTTCTCGAGAAATCCGTGTCAAAGTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003809
DLGAP1 MISSION shRNA Bacterial Glycerol Stock
discs, large (Drosophila) homolog-associated protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003809.1-2235s1c1
Sequence:CCGGCCGTTTGCCCATCTCCTTCTTCTCGAGAAGAAGGAGATGGGCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003809.1-226s1c1
Sequence:CCGGGCGGAGAGAAAGCTATCTCAACTCGAGTTGAGATAGCTTTCTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003809.1-104s1c1
Sequence:CCGGCGAGGTAAAGATGATGAAATTCTCGAGAATTTCATCATCTTTACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003809.1-1582s1c1
Sequence:CCGGGCCCGAAGACATTCTAGGAAACTCGAGTTTCCTAGAATGTCTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003809.1-702s1c1
Sequence:CCGGCGGTGTCATCTTGCATTACAACTCGAGTTGTAATGCAAGATGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003809.1-835s21c1
Sequence:CCGGGGGCCAGCGAGGAGATATTATCTCGAGATAATATCTCCTCGCTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003809.1-1375s21c1
Sequence:CCGGTGATGACTTTGACACGGATTTCTCGAGAAATCCGTGTCAAAGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003809.1-134s21c1
Sequence:CCGGAGAATGCGGAGTGGCAGTTATCTCGAGATAACTGCCACTCCGCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003809
DLGAP1 MISSION shRNA shRNA Plasmid DNA
discs, large (Drosophila) homolog-associated protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003809.1-2235s1c1
Sequence:CCGGCCGTTTGCCCATCTCCTTCTTCTCGAGAAGAAGGAGATGGGCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003809.1-226s1c1
Sequence:CCGGGCGGAGAGAAAGCTATCTCAACTCGAGTTGAGATAGCTTTCTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003809.1-104s1c1
Sequence:CCGGCGAGGTAAAGATGATGAAATTCTCGAGAATTTCATCATCTTTACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003809.1-1582s1c1
Sequence:CCGGGCCCGAAGACATTCTAGGAAACTCGAGTTTCCTAGAATGTCTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003809.1-702s1c1
Sequence:CCGGCGGTGTCATCTTGCATTACAACTCGAGTTGTAATGCAAGATGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003809.1-835s21c1
Sequence:CCGGGGGCCAGCGAGGAGATATTATCTCGAGATAATATCTCCTCGCTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003809.1-1375s21c1
Sequence:CCGGTGATGACTTTGACACGGATTTCTCGAGAAATCCGTGTCAAAGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003809.1-134s21c1
Sequence:CCGGAGAATGCGGAGTGGCAGTTATCTCGAGATAACTGCCACTCCGCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003809
DLGAP1 MISSION shRNA Lentiviral Transduction Particles
discs, large (Drosophila) homolog-associated protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003809.1-2235s1c1
Sequence:CCGGCCGTTTGCCCATCTCCTTCTTCTCGAGAAGAAGGAGATGGGCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003809.1-226s1c1
Sequence:CCGGGCGGAGAGAAAGCTATCTCAACTCGAGTTGAGATAGCTTTCTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003809.1-104s1c1
Sequence:CCGGCGAGGTAAAGATGATGAAATTCTCGAGAATTTCATCATCTTTACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003809.1-1582s1c1
Sequence:CCGGGCCCGAAGACATTCTAGGAAACTCGAGTTTCCTAGAATGTCTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003809.1-702s1c1
Sequence:CCGGCGGTGTCATCTTGCATTACAACTCGAGTTGTAATGCAAGATGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003809.1-835s21c1
Sequence:CCGGGGGCCAGCGAGGAGATATTATCTCGAGATAATATCTCCTCGCTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003809.1-1375s21c1
Sequence:CCGGTGATGACTTTGACACGGATTTCTCGAGAAATCCGTGTCAAAGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003809.1-134s21c1
Sequence:CCGGAGAATGCGGAGTGGCAGTTATCTCGAGATAACTGCCACTCCGCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks