EMAIL THIS PAGE TO A FRIEND

DLGAP2

discs, large (Drosophila) homolog-associated protein 2

197 Gene Product Result for
Synonyms: DAP2 SAPAP2
Gene ID:
Human(9228) Summary: The product of this gene is a membrane-associated guanylate kinase. The encoded protein may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Mar 2013]
Mouse(244310) discs, large (Drosophila) homolog-associated protein 2
Rat(116681) discs, large (Drosophila) homolog-associated protein 2
Zebrafish(557621) discs, large (Drosophila) homolog-associated protein 2
cow(784511) discs, large (Drosophila) homolog-associated protein 2
cow(100847272) discs, large (Drosophila) homolog-associated protein 2
dog(488556) discs, large (Drosophila) homolog-associated protein 2
domestic cat(101081537) discs, large (Drosophila) homolog-associated protein 2
chicken(421903) discs, large (Drosophila) homolog-associated protein 2
naked mole-rat(101701628) discs, large (Drosophila) homolog-associated protein 2
domestic guinea pig(100722596) discs, large (Drosophila) homolog-associated protein 2
sheep(101102620) discs, large (Drosophila) homolog-associated protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004745 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172910 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172910 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172910 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079711 MISSION® esiRNA esiRNA human DLGAP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004745 Rosetta Predictions human pricing
NM_053901 Rosetta Predictions rat pricing
NM_172910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202317 predicted 1607
2 SASI_Hs01_00202318 predicted 1151
3 SASI_Hs01_00202320 predicted 1650
4 SASI_Hs02_00338227 predicted 869
5 SASI_Hs01_00202321 predicted 1628
6 SASI_Hs01_00202322 predicted 2720
7 SASI_Hs01_00202323 predicted 2290
8 SASI_Hs01_00202324 predicted 1213
9 SASI_Hs01_00202325 predicted 1828
10 SASI_Hs01_00202326 predicted 1564
11 SASI_Hs01_00202319 predicted 2497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106197 predicted 1892
2 SASI_Rn01_00106198 predicted 2270
3 SASI_Rn02_00266825 predicted 3166
4 SASI_Rn01_00106200 predicted 2556
5 SASI_Rn02_00266826 predicted 1854
6 SASI_Rn01_00106202 predicted 1991
7 SASI_Rn02_00266827 predicted 2904
8 SASI_Rn02_00266828 predicted 2961
9 SASI_Rn01_00106205 predicted 1297
10 SASI_Rn02_00266829 predicted 967
11 SASI_Rn01_00106199 predicted 2248
12 SASI_Rn01_00106201 predicted 3480
13 SASI_Rn01_00106203 predicted 1137
14 SASI_Rn01_00106204 predicted 494
15 SASI_Rn01_00106206 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195977 predicted 1045
2 SASI_Mm01_00195978 predicted 711
3 SASI_Mm01_00195979 predicted 2336
4 SASI_Mm02_00344897 predicted 2610
5 SASI_Mm01_00195980 predicted 594
6 SASI_Mm01_00195981 predicted 382
7 SASI_Mm01_00195982 predicted 700
8 SASI_Mm01_00195984 predicted 809
9 SASI_Mm01_00195985 predicted 2362
10 SASI_Mm01_00195986 predicted 3275
11 SASI_Mm01_00195983 predicted 2095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004745
DLGAP2 MISSION shRNA Bacterial Glycerol Stock
discs, large (Drosophila) homolog-associated protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004745.3-1456s21c1
Sequence:CCGGGGCGGAGATCAATGGGCAATTCTCGAGAATTGCCCATTGATCTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004745.3-1666s21c1
Sequence:CCGGAGCTGTCTCATATACAAATTACTCGAGTAATTTGTATATGAGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004745.3-1223s21c1
Sequence:CCGGACATCACCAAAGTCGGCAATCCTCGAGGATTGCCGACTTTGGTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004745.3-3397s21c1
Sequence:CCGGGAGGTAAGAATAACAAGTAACCTCGAGGTTACTTGTTATTCTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-2767s1c1
Sequence:CCGGGCTCAACGACTGGAAGATGATCTCGAGATCATCTTCCAGTCGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-1150s1c1
Sequence:CCGGGAGAATGAGAAGTGGGAGTTACTCGAGTAACTCCCACTTCTCATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-1606s1c1
Sequence:CCGGTGACGAATGTATTCCCATGATCTCGAGATCATGGGAATACATTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-1490s1c1
Sequence:CCGGGAGTCCGTCTTCAGTGAAGTTCTCGAGAACTTCACTGAAGACGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-2552s1c1
Sequence:CCGGTCGGAGGAAATTCTCGGTAAACTCGAGTTTACCGAGAATTTCCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004745
DLGAP2 MISSION shRNA shRNA Plasmid DNA
discs, large (Drosophila) homolog-associated protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004745.3-1456s21c1
Sequence:CCGGGGCGGAGATCAATGGGCAATTCTCGAGAATTGCCCATTGATCTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004745.3-1666s21c1
Sequence:CCGGAGCTGTCTCATATACAAATTACTCGAGTAATTTGTATATGAGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004745.3-1223s21c1
Sequence:CCGGACATCACCAAAGTCGGCAATCCTCGAGGATTGCCGACTTTGGTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004745.3-3397s21c1
Sequence:CCGGGAGGTAAGAATAACAAGTAACCTCGAGGTTACTTGTTATTCTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-2767s1c1
Sequence:CCGGGCTCAACGACTGGAAGATGATCTCGAGATCATCTTCCAGTCGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-1150s1c1
Sequence:CCGGGAGAATGAGAAGTGGGAGTTACTCGAGTAACTCCCACTTCTCATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-1606s1c1
Sequence:CCGGTGACGAATGTATTCCCATGATCTCGAGATCATGGGAATACATTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-1490s1c1
Sequence:CCGGGAGTCCGTCTTCAGTGAAGTTCTCGAGAACTTCACTGAAGACGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-2552s1c1
Sequence:CCGGTCGGAGGAAATTCTCGGTAAACTCGAGTTTACCGAGAATTTCCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004745
DLGAP2 MISSION shRNA Lentiviral Transduction Particles
discs, large (Drosophila) homolog-associated protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004745.3-1456s21c1
Sequence:CCGGGGCGGAGATCAATGGGCAATTCTCGAGAATTGCCCATTGATCTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004745.3-1666s21c1
Sequence:CCGGAGCTGTCTCATATACAAATTACTCGAGTAATTTGTATATGAGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004745.3-1223s21c1
Sequence:CCGGACATCACCAAAGTCGGCAATCCTCGAGGATTGCCGACTTTGGTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004745.3-3397s21c1
Sequence:CCGGGAGGTAAGAATAACAAGTAACCTCGAGGTTACTTGTTATTCTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-2767s1c1
Sequence:CCGGGCTCAACGACTGGAAGATGATCTCGAGATCATCTTCCAGTCGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-1150s1c1
Sequence:CCGGGAGAATGAGAAGTGGGAGTTACTCGAGTAACTCCCACTTCTCATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-1606s1c1
Sequence:CCGGTGACGAATGTATTCCCATGATCTCGAGATCATGGGAATACATTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-1490s1c1
Sequence:CCGGGAGTCCGTCTTCAGTGAAGTTCTCGAGAACTTCACTGAAGACGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004745.3-2552s1c1
Sequence:CCGGTCGGAGGAAATTCTCGGTAAACTCGAGTTTACCGAGAATTTCCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172910
DLGAP2 MISSION shRNA Bacterial Glycerol Stock
discs, large (Drosophila) homolog-associated protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172910.1-1769s1c1
Sequence:CCGGCCCATCATACAAAGACCACTTCTCGAGAAGTGGTCTTTGTATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172910.1-2110s1c1
Sequence:CCGGCGATGAATGTATTCCCGTGATCTCGAGATCACGGGAATACATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172910.1-3809s1c1
Sequence:CCGGCCTAGCTTTCACTTTGTTATTCTCGAGAATAACAAAGTGAAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172910.1-581s1c1
Sequence:CCGGCCCAGGAACATGAAAGGGTTACTCGAGTAACCCTTTCATGTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172910.1-3274s1c1
Sequence:CCGGGCTCAATGACTGGAAGATAATCTCGAGATTATCTTCCAGTCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172910
DLGAP2 MISSION shRNA shRNA Plasmid DNA
discs, large (Drosophila) homolog-associated protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172910.1-1769s1c1
Sequence:CCGGCCCATCATACAAAGACCACTTCTCGAGAAGTGGTCTTTGTATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172910.1-2110s1c1
Sequence:CCGGCGATGAATGTATTCCCGTGATCTCGAGATCACGGGAATACATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172910.1-3809s1c1
Sequence:CCGGCCTAGCTTTCACTTTGTTATTCTCGAGAATAACAAAGTGAAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172910.1-581s1c1
Sequence:CCGGCCCAGGAACATGAAAGGGTTACTCGAGTAACCCTTTCATGTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172910.1-3274s1c1
Sequence:CCGGGCTCAATGACTGGAAGATAATCTCGAGATTATCTTCCAGTCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172910
DLGAP2 MISSION shRNA Lentiviral Transduction Particles
discs, large (Drosophila) homolog-associated protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172910.1-1769s1c1
Sequence:CCGGCCCATCATACAAAGACCACTTCTCGAGAAGTGGTCTTTGTATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172910.1-2110s1c1
Sequence:CCGGCGATGAATGTATTCCCGTGATCTCGAGATCACGGGAATACATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172910.1-3809s1c1
Sequence:CCGGCCTAGCTTTCACTTTGTTATTCTCGAGAATAACAAAGTGAAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172910.1-581s1c1
Sequence:CCGGCCCAGGAACATGAAAGGGTTACTCGAGTAACCCTTTCATGTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172910.1-3274s1c1
Sequence:CCGGGCTCAATGACTGGAAGATAATCTCGAGATTATCTTCCAGTCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks