EMAIL THIS PAGE TO A FRIEND

DLGAP3

discs, large (Drosophila) homolog-associated protein 3

88 Gene Product Result for
Synonyms: DAP3 SAPAP3
UniProtKB ID: O95886, Q5TDD5, Q9H3X7
Gene ID:
Mouse(242667) discs, large (Drosophila) homolog-associated protein 3
Rat(286923) discs, large (Drosophila) homolog-associated protein 3
Zebrafish(557556) discs, large (Drosophila) homolog-associated protein 3
chicken(419638) discs, large (Drosophila) homolog-associated protein 3
domestic cat(101084556) discs, large (Drosophila) homolog-associated protein 3
cow(516070) discs, large (Drosophila) homolog-associated protein 3
Horse(100069732) discs, large (Drosophila) homolog-associated protein 3
dog(475342) discs, large (Drosophila) homolog-associated protein 3
sheep(101114484) discs, large (Drosophila) homolog-associated protein 3
domestic guinea pig(100729368) discs, large (Drosophila) homolog-associated protein 3
naked mole-rat(101707003) discs, large (Drosophila) homolog-associated protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198618 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198618 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198618 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080418 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080418 Rosetta Predictions human pricing
XM_035601 Rosetta Predictions human pricing
NM_173138 Rosetta Predictions rat pricing
NM_198618 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314656 predicted 1389
2 SASI_Hs02_00314657 predicted 1375
3 SASI_Hs02_00314658 predicted 979
4 SASI_Hs02_00314659 predicted 2513
5 SASI_Hs02_00314660 predicted 1095
6 SASI_Hs02_00314661 predicted 2566
7 SASI_Hs02_00314662 predicted 1229
8 SASI_Hs02_00314663 predicted 1925
9 SASI_Hs02_00314664 predicted 1074
10 SASI_Hs02_00314665 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_035601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252984 predicted 1388
2 SASI_Hs01_00252985 predicted 1999
3 SASI_Hs01_00252986 predicted 1374
4 SASI_Hs01_00252987 predicted 980
5 SASI_Hs01_00252988 predicted 2521
6 SASI_Hs01_00252989 predicted 1097
7 SASI_Hs01_00252990 predicted 2568
8 SASI_Hs01_00252991 predicted 1930
9 SASI_Hs01_00252992 predicted 1080
10 SASI_Hs01_00252993 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096484 predicted 2047
2 SASI_Rn01_00096485 predicted 2625
3 SASI_Rn02_00269315 predicted 1361
4 SASI_Rn01_00096486 predicted 1463
5 SASI_Rn01_00096487 predicted 1075
6 SASI_Rn01_00096488 predicted 1078
7 SASI_Rn01_00096489 predicted 2826
8 SASI_Rn01_00096490 predicted 1186
9 SASI_Rn01_00096491 predicted 2758
10 SASI_Rn01_00096492 predicted 1053
11 SASI_Rn01_00096483 predicted 2619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150594 predicted 1981
2 SASI_Mm01_00150595 predicted 1951
3 SASI_Mm01_00150596 predicted 3137
4 SASI_Mm02_00351055 predicted 3127
5 SASI_Mm01_00150597 predicted 1879
6 SASI_Mm01_00150598 predicted 3937
7 SASI_Mm01_00150599 predicted 3337
8 SASI_Mm01_00150600 predicted 1706
9 SASI_Mm01_00150601 predicted 1969
10 SASI_Mm02_00351056 predicted 2580
11 SASI_Mm01_00150602 predicted 2768
12 SASI_Mm01_00150603 predicted 1604
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198618
DLGAP3 MISSION shRNA Bacterial Glycerol Stock
discs, large (Drosophila) homolog-associated protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-1605s1c1
Sequence:CCGGGACAGCTAAGCGAAGAGTTTACTCGAGTAAACTCTTCGCTTAGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-742s1c1
Sequence:CCGGCCTGGTTCACTCAGTGCAGAACTCGAGTTCTGCACTGAGTGAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-2893s1c1
Sequence:CCGGCCTGGAACTACAACAACTCAACTCGAGTTGAGTTGTTGTAGTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-2608s1c1
Sequence:CCGGCGAGTGGTTCATCAAGATGCTCTCGAGAGCATCTTGATGAACCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-1306s1c1
Sequence:CCGGAGCCAGGACTTATCACTATTTCTCGAGAAATAGTGATAAGTCCTGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198618
DLGAP3 MISSION shRNA shRNA Plasmid DNA
discs, large (Drosophila) homolog-associated protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-1605s1c1
Sequence:CCGGGACAGCTAAGCGAAGAGTTTACTCGAGTAAACTCTTCGCTTAGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-742s1c1
Sequence:CCGGCCTGGTTCACTCAGTGCAGAACTCGAGTTCTGCACTGAGTGAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-2893s1c1
Sequence:CCGGCCTGGAACTACAACAACTCAACTCGAGTTGAGTTGTTGTAGTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-2608s1c1
Sequence:CCGGCGAGTGGTTCATCAAGATGCTCTCGAGAGCATCTTGATGAACCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-1306s1c1
Sequence:CCGGAGCCAGGACTTATCACTATTTCTCGAGAAATAGTGATAAGTCCTGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198618
DLGAP3 MISSION shRNA Lentiviral Transduction Particles
discs, large (Drosophila) homolog-associated protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-1605s1c1
Sequence:CCGGGACAGCTAAGCGAAGAGTTTACTCGAGTAAACTCTTCGCTTAGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-742s1c1
Sequence:CCGGCCTGGTTCACTCAGTGCAGAACTCGAGTTCTGCACTGAGTGAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-2893s1c1
Sequence:CCGGCCTGGAACTACAACAACTCAACTCGAGTTGAGTTGTTGTAGTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-2608s1c1
Sequence:CCGGCGAGTGGTTCATCAAGATGCTCTCGAGAGCATCTTGATGAACCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198618.1-1306s1c1
Sequence:CCGGAGCCAGGACTTATCACTATTTCTCGAGAAATAGTGATAAGTCCTGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080418
DLGAP3 MISSION shRNA Bacterial Glycerol Stock
discs, large (Drosophila) homolog-associated protein 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080418.1-3224s21c1
Sequence:CCGGCACCATCTCTGCCATTCTTTCCTCGAGGAAAGAATGGCAGAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080418.1-356s21c1
Sequence:CCGGCTACACTCCTGGATCAGTTTGCTCGAGCAAACTGATCCAGGAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080418.1-1076s21c1
Sequence:CCGGAGGCCAAAGCCAGGACTTATCCTCGAGGATAAGTCCTGGCTTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080418.1-1954s21c1
Sequence:CCGGCGGAGGGAGTTCCACTCTATTCTCGAGAATAGAGTGGAACTCCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080418.1-2006s21c1
Sequence:CCGGCAAGGTTCAAGCGCTCCAATACTCGAGTATTGGAGCGCTTGAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080418
DLGAP3 MISSION shRNA shRNA Plasmid DNA
discs, large (Drosophila) homolog-associated protein 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080418.1-3224s21c1
Sequence:CCGGCACCATCTCTGCCATTCTTTCCTCGAGGAAAGAATGGCAGAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080418.1-356s21c1
Sequence:CCGGCTACACTCCTGGATCAGTTTGCTCGAGCAAACTGATCCAGGAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080418.1-1076s21c1
Sequence:CCGGAGGCCAAAGCCAGGACTTATCCTCGAGGATAAGTCCTGGCTTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080418.1-1954s21c1
Sequence:CCGGCGGAGGGAGTTCCACTCTATTCTCGAGAATAGAGTGGAACTCCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080418.1-2006s21c1
Sequence:CCGGCAAGGTTCAAGCGCTCCAATACTCGAGTATTGGAGCGCTTGAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080418
DLGAP3 MISSION shRNA Lentiviral Transduction Particles
discs, large (Drosophila) homolog-associated protein 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080418.1-3224s21c1
Sequence:CCGGCACCATCTCTGCCATTCTTTCCTCGAGGAAAGAATGGCAGAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080418.1-356s21c1
Sequence:CCGGCTACACTCCTGGATCAGTTTGCTCGAGCAAACTGATCCAGGAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080418.1-1076s21c1
Sequence:CCGGAGGCCAAAGCCAGGACTTATCCTCGAGGATAAGTCCTGGCTTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080418.1-1954s21c1
Sequence:CCGGCGGAGGGAGTTCCACTCTATTCTCGAGAATAGAGTGGAACTCCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080418.1-2006s21c1
Sequence:CCGGCAAGGTTCAAGCGCTCCAATACTCGAGTATTGGAGCGCTTGAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks