EMAIL THIS PAGE TO A FRIEND

DLGAP4

discs, large (Drosophila) homolog-associated protein 4

205 Gene Product Result for
Synonyms: DAP4 DLP4 RP5-977B1.6 SAPAP4
Gene ID:
Human(22839) Summary: The product of this gene is a membrane-associated guanylate kinase found at the postsynaptic density in neuronal cells. It is a signaling molecule that can interact with potassium channels and receptors, as well as other signaling molecules. The protein encoded by this gene can interact with PSD-95 through its guanylate kinase domain and may be involved in clustering PSD-95 in the postsynaptic density region. The encoded protein is one of at least four similar proteins that have been found. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(228836) discs, large homolog-associated protein 4 (Drosophila)
Rat(286930) discs, large (Drosophila) homolog-associated protein 4
naked mole-rat(101717179) discs, large (Drosophila) homolog-associated protein 4
domestic guinea pig(100725292) discs, large (Drosophila) homolog-associated protein 4
sheep(101121283) discs, large (Drosophila) homolog-associated protein 4
Domestic Rabbit(100354420) discs, large (Drosophila) homolog-associated protein 4
Zebrafish(569107) discs, large (Drosophila) homolog-associated protein 4
dog(477219) discs, large (Drosophila) homolog-associated protein 4
cow(520521) discs, large (Drosophila) homolog-associated protein 4
Horse(100055151) discs, large (Drosophila) homolog-associated protein 4
domestic cat(101098293) discs, large (Drosophila) homolog-associated protein 4
chicken(419119) discs, large (Drosophila) homolog-associated protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146128 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146128 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146128 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014902 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042486 Rosetta Predictions human pricing
NM_014902 Rosetta Predictions human pricing
NM_183006 Rosetta Predictions human pricing
NM_173145 Rosetta Predictions rat pricing
NM_001042487 Rosetta Predictions mouse pricing
NM_001042488 Rosetta Predictions mouse pricing
NM_146128 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310108 predicted 946
2 SASI_Hs02_00310109 predicted 937
3 SASI_Hs02_00310110 predicted 1078
4 SASI_Hs02_00310111 predicted 939
5 SASI_Hs02_00310112 predicted 898
6 SASI_Hs02_00310113 predicted 1179
7 SASI_Hs02_00310114 predicted 1055
8 SASI_Hs02_00310115 predicted 888
9 SASI_Hs02_00310116 predicted 885
10 SASI_Hs02_00310117 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116260 predicted 2971
2 SASI_Hs01_00116262 predicted 2972
3 SASI_Hs01_00116263 predicted 3111
4 SASI_Hs01_00116264 predicted 2968
5 SASI_Hs01_00116267 predicted 2922
6 SASI_Hs02_00346532 predicted 3203
7 SASI_Hs02_00346533 predicted 3084
8 SASI_Hs02_00346534 predicted 2921
9 SASI_Hs02_00346535 predicted 2915
10 SASI_Hs02_00346536 predicted 3358
11 SASI_Hs01_00116261 predicted 2839
12 SASI_Hs01_00116265 predicted 2843
13 SASI_Hs01_00116266 predicted 3329
14 SASI_Hs01_00116268 predicted 2848
15 SASI_Hs01_00116269 predicted 3359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091245 predicted 1762
2 SASI_Hs01_00091247 predicted 1757
3 SASI_Hs01_00091248 predicted 1890
4 SASI_Hs01_00091249 predicted 1754
5 SASI_Hs01_00091252 predicted 1713
6 SASI_Hs02_00371166 predicted 1995
7 SASI_Hs02_00371167 predicted 1879
8 SASI_Hs02_00371168 predicted 1708
9 SASI_Hs02_00371169 predicted 1699
10 SASI_Hs02_00371170 predicted 2144
11 SASI_Hs01_00091246 predicted 1626
12 SASI_Hs01_00091250 predicted 1626
13 SASI_Hs01_00091251 predicted 2110
14 SASI_Hs01_00091253 predicted 1638
15 SASI_Hs01_00091254 predicted 2144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040715 predicted 2361
2 SASI_Rn01_00040716 predicted 919
3 SASI_Rn01_00040717 predicted 534
4 SASI_Rn01_00040718 predicted 1528
5 SASI_Rn01_00040720 predicted 2470
6 SASI_Rn01_00040721 predicted 1973
7 SASI_Rn02_00269326 predicted 1976
8 SASI_Rn01_00040723 predicted 2700
9 SASI_Rn01_00040724 predicted 1855
10 SASI_Rn02_00269327 predicted 1998
11 SASI_Rn01_00040719 predicted 2880
12 SASI_Rn01_00040722 predicted 2660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290415 predicted 1237
2 SASI_Mm02_00290416 predicted 1743
3 SASI_Mm02_00290417 predicted 1158
4 SASI_Mm02_00290418 predicted 1315
5 SASI_Mm02_00290419 predicted 1437
6 SASI_Mm02_00290420 predicted 1083
7 SASI_Mm02_00290421 predicted 1335
8 SASI_Mm02_00290422 predicted 1854
9 SASI_Mm02_00290423 predicted 2604
10 SASI_Mm02_00290424 predicted 2076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290425 predicted 1025
2 SASI_Mm02_00290426 predicted 617
3 SASI_Mm02_00290427 predicted 1003
4 SASI_Mm02_00290428 predicted 599
5 SASI_Mm02_00290429 predicted 720
6 SASI_Mm02_00290430 predicted 609
7 SASI_Mm02_00290431 predicted 1133
8 SASI_Mm02_00290432 predicted 1877
9 SASI_Mm02_00290433 predicted 1363
10 SASI_Mm02_00290434 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341796 predicted 2477
2 SASI_Mm02_00341797 predicted 2984
3 SASI_Mm02_00341798 predicted 2394
4 SASI_Mm01_00094986 predicted 2556
5 SASI_Mm01_00094988 predicted 2672
6 SASI_Mm02_00341799 predicted 2316
7 SASI_Mm02_00341800 predicted 2573
8 SASI_Mm01_00094990 predicted 3098
9 SASI_Mm02_00341801 predicted 3839
10 SASI_Mm02_00341802 predicted 3318
11 SASI_Mm01_00094983 predicted 2014
12 SASI_Mm01_00094984 predicted 712
13 SASI_Mm01_00094985 predicted 2500
14 SASI_Mm01_00094987 predicted 920
15 SASI_Mm01_00094989 predicted 1329
16 SASI_Mm01_00094991 predicted 1651
17 SASI_Mm01_00094992 predicted 2079
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146128
DLGAP4 MISSION shRNA Bacterial Glycerol Stock
discs, large (Drosophila) homolog-associated protein 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146128.5-687s21c1
Sequence:CCGGCCCAAGCCACTAAGATCAATCCTCGAGGATTGATCTTAGTGGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146128.5-1260s21c1
Sequence:CCGGCCGACACCAACTATGTCAAACCTCGAGGTTTGACATAGTTGGTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146128.5-3459s21c1
Sequence:CCGGCACCCTTCAGTATGGTTATTACTCGAGTAATAACCATACTGAAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146128.5-3345s21c1
Sequence:CCGGCGGACAGCATCGAGATTTATGCTCGAGCATAAATCTCGATGCTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146128.5-1382s21c1
Sequence:CCGGCAGGGTTTGGCCTACCATTACCTCGAGGTAATGGTAGGCCAAACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146128.3-1637s1c1
Sequence:CCGGGCACGCTTCCAAGTTCATCATCTCGAGATGATGAACTTGGAAGCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146128.3-2049s1c1
Sequence:CCGGCGCTACCAAATTCGAGTCCATCTCGAGATGGACTCGAATTTGGTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146128
DLGAP4 MISSION shRNA shRNA Plasmid DNA
discs, large (Drosophila) homolog-associated protein 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146128.5-687s21c1
Sequence:CCGGCCCAAGCCACTAAGATCAATCCTCGAGGATTGATCTTAGTGGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146128.5-1260s21c1
Sequence:CCGGCCGACACCAACTATGTCAAACCTCGAGGTTTGACATAGTTGGTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146128.5-3459s21c1
Sequence:CCGGCACCCTTCAGTATGGTTATTACTCGAGTAATAACCATACTGAAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146128.5-3345s21c1
Sequence:CCGGCGGACAGCATCGAGATTTATGCTCGAGCATAAATCTCGATGCTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146128.5-1382s21c1
Sequence:CCGGCAGGGTTTGGCCTACCATTACCTCGAGGTAATGGTAGGCCAAACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146128.3-1637s1c1
Sequence:CCGGGCACGCTTCCAAGTTCATCATCTCGAGATGATGAACTTGGAAGCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146128.3-2049s1c1
Sequence:CCGGCGCTACCAAATTCGAGTCCATCTCGAGATGGACTCGAATTTGGTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146128
DLGAP4 MISSION shRNA Lentiviral Transduction Particles
discs, large (Drosophila) homolog-associated protein 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146128.5-687s21c1
Sequence:CCGGCCCAAGCCACTAAGATCAATCCTCGAGGATTGATCTTAGTGGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146128.5-1260s21c1
Sequence:CCGGCCGACACCAACTATGTCAAACCTCGAGGTTTGACATAGTTGGTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146128.5-3459s21c1
Sequence:CCGGCACCCTTCAGTATGGTTATTACTCGAGTAATAACCATACTGAAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146128.5-3345s21c1
Sequence:CCGGCGGACAGCATCGAGATTTATGCTCGAGCATAAATCTCGATGCTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146128.5-1382s21c1
Sequence:CCGGCAGGGTTTGGCCTACCATTACCTCGAGGTAATGGTAGGCCAAACCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146128.3-1637s1c1
Sequence:CCGGGCACGCTTCCAAGTTCATCATCTCGAGATGATGAACTTGGAAGCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146128.3-2049s1c1
Sequence:CCGGCGCTACCAAATTCGAGTCCATCTCGAGATGGACTCGAATTTGGTAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014902
DLGAP4 MISSION shRNA Bacterial Glycerol Stock
discs, large (Drosophila) homolog-associated protein 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.3-1380s1c1
Sequence:CCGGGAGCCTGCTCAAGTCCAAATCCTCGAGGATTTGGACTTGAGCAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.3-2088s1c1
Sequence:CCGGATCATGCCTAGTGGCGTATAACTCGAGTTATACGCCACTAGGCATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.3-1286s1c1
Sequence:CCGGCTGACACCAACTACGTCAAACCTCGAGGTTTGACGTAGTTGGTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014902.2-4099s1c1
Sequence:CCGGGCTGAGCAGATGAGAGAAGTTCTCGAGAACTTCTCTCATCTGCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014902.2-3412s1c1
Sequence:CCGGGCAGGAGGAAAGAAACGATTTCTCGAGAAATCGTTTCTTTCCTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014902.2-3358s1c1
Sequence:CCGGGCAGACAGCATCGAGATTTATCTCGAGATAAATCTCGATGCTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014902.2-2438s1c1
Sequence:CCGGGAATACAAGAGAGGACTAGAACTCGAGTTCTAGTCCTCTCTTGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.2-3102s1c1
Sequence:CCGGCGAGGATATCAGCATGAAGTTCTCGAGAACTTCATGCTGATATCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.2-2974s1c1
Sequence:CCGGCAGCTACTGATGTCCCAGAAACTCGAGTTTCTGGGACATCAGTAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014902.2-3520s1c1
Sequence:CCGGCCAACTTTCAAATTGACGCATCTCGAGATGCGTCAATTTGAAAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014902.2-2600s1c1
Sequence:CCGGGCTGTAAGTCATCTGAGAGGACTCGAGTCCTCTCAGATGACTTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014902
DLGAP4 MISSION shRNA shRNA Plasmid DNA
discs, large (Drosophila) homolog-associated protein 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.3-1380s1c1
Sequence:CCGGGAGCCTGCTCAAGTCCAAATCCTCGAGGATTTGGACTTGAGCAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.3-2088s1c1
Sequence:CCGGATCATGCCTAGTGGCGTATAACTCGAGTTATACGCCACTAGGCATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.3-1286s1c1
Sequence:CCGGCTGACACCAACTACGTCAAACCTCGAGGTTTGACGTAGTTGGTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014902.2-4099s1c1
Sequence:CCGGGCTGAGCAGATGAGAGAAGTTCTCGAGAACTTCTCTCATCTGCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014902.2-3412s1c1
Sequence:CCGGGCAGGAGGAAAGAAACGATTTCTCGAGAAATCGTTTCTTTCCTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014902.2-3358s1c1
Sequence:CCGGGCAGACAGCATCGAGATTTATCTCGAGATAAATCTCGATGCTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014902.2-2438s1c1
Sequence:CCGGGAATACAAGAGAGGACTAGAACTCGAGTTCTAGTCCTCTCTTGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.2-3102s1c1
Sequence:CCGGCGAGGATATCAGCATGAAGTTCTCGAGAACTTCATGCTGATATCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.2-2974s1c1
Sequence:CCGGCAGCTACTGATGTCCCAGAAACTCGAGTTTCTGGGACATCAGTAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014902.2-3520s1c1
Sequence:CCGGCCAACTTTCAAATTGACGCATCTCGAGATGCGTCAATTTGAAAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014902.2-2600s1c1
Sequence:CCGGGCTGTAAGTCATCTGAGAGGACTCGAGTCCTCTCAGATGACTTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014902
DLGAP4 MISSION shRNA Lentiviral Transduction Particles
discs, large (Drosophila) homolog-associated protein 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.3-1380s1c1
Sequence:CCGGGAGCCTGCTCAAGTCCAAATCCTCGAGGATTTGGACTTGAGCAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.3-2088s1c1
Sequence:CCGGATCATGCCTAGTGGCGTATAACTCGAGTTATACGCCACTAGGCATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.3-1286s1c1
Sequence:CCGGCTGACACCAACTACGTCAAACCTCGAGGTTTGACGTAGTTGGTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014902.2-4099s1c1
Sequence:CCGGGCTGAGCAGATGAGAGAAGTTCTCGAGAACTTCTCTCATCTGCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014902.2-3412s1c1
Sequence:CCGGGCAGGAGGAAAGAAACGATTTCTCGAGAAATCGTTTCTTTCCTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014902.2-3358s1c1
Sequence:CCGGGCAGACAGCATCGAGATTTATCTCGAGATAAATCTCGATGCTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014902.2-2438s1c1
Sequence:CCGGGAATACAAGAGAGGACTAGAACTCGAGTTCTAGTCCTCTCTTGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.2-3102s1c1
Sequence:CCGGCGAGGATATCAGCATGAAGTTCTCGAGAACTTCATGCTGATATCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014902.2-2974s1c1
Sequence:CCGGCAGCTACTGATGTCCCAGAAACTCGAGTTTCTGGGACATCAGTAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014902.2-3520s1c1
Sequence:CCGGCCAACTTTCAAATTGACGCATCTCGAGATGCGTCAATTTGAAAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014902.2-2600s1c1
Sequence:CCGGGCTGTAAGTCATCTGAGAGGACTCGAGTCCTCTCAGATGACTTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)