EMAIL THIS PAGE TO A FRIEND

DLGAP5

discs, large (Drosophila) homolog-associated protein 5

Synonyms: DLG7 HURP
UniProtKB ID: Q15398, A8MTM6, B4DRM8, Q86T11, Q8NG58
Gene ID:
Mouse(218977) discs, large (Drosophila) homolog-associated protein 5
Rat(289997) discs, large (Drosophila) homolog-associated protein 5
Zebrafish(447853) discs, large (Drosophila) homolog-associated protein 5
cow(509161) discs, large (Drosophila) homolog-associated protein 5
domestic cat(101081734) discs, large (Drosophila) homolog-associated protein 5
dog(480331) discs, large (Drosophila) homolog-associated protein 5
chicken(423555) discs, large (Drosophila) homolog-associated protein 5
sheep(101118701) discs, large (Drosophila) homolog-associated protein 5
Domestic Rabbit(100349693) discs, large (Drosophila) homolog-associated protein 5
domestic guinea pig(100732673) discs, large (Drosophila) homolog-associated protein 5
naked mole-rat(101702003) discs, large (Drosophila) homolog-associated protein 5
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144553 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144553 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144553 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014750 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014750 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014750 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014750 Rosetta Predictions human pricing
XM_001073486 Rosetta Predictions rat pricing
XM_223937 Rosetta Predictions rat pricing
NM_144553 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103537 predicted 336
2 SASI_Hs01_00103538 predicted 416
3 SASI_Hs02_00346217 predicted 377
4 SASI_Hs01_00103539 predicted 1324
5 SASI_Hs01_00103540 predicted 1230
6 SASI_Hs01_00103541 predicted 1628
7 SASI_Hs01_00103542 predicted 1699
8 SASI_Hs01_00103543 predicted 1315
9 SASI_Hs01_00103544 predicted 2148
10 SASI_Hs01_00103545 predicted 688
11 SASI_Hs01_00103536 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073486 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343031 predicted 1443
2 SASI_Rn02_00343032 predicted 1097
3 SASI_Rn02_00343033 predicted 249
4 SASI_Rn02_00343034 predicted 2453
5 SASI_Rn02_00343035 predicted 1716
6 SASI_Rn02_00343036 predicted 1469
7 SASI_Rn02_00343037 predicted 1212
8 SASI_Rn02_00343038 predicted 2184
9 SASI_Rn02_00343039 predicted 2078
10 SASI_Rn02_00343040 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381744 predicted 1391
2 SASI_Rn02_00381745 predicted 194
3 SASI_Rn02_00381746 predicted 2061
4 SASI_Rn02_00381747 predicted 2401
5 SASI_Rn02_00381748 predicted 1675
6 SASI_Rn02_00381749 predicted 1417
7 SASI_Rn02_00381750 predicted 2054
8 SASI_Rn02_00381751 predicted 2136
9 SASI_Rn02_00381752 predicted 2026
10 SASI_Rn02_00381753 predicted 1909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340091 predicted 2330
2 SASI_Mm02_00340092 predicted 360
3 SASI_Mm02_00340093 predicted 1691
4 SASI_Mm02_00340094 predicted 2326
5 SASI_Mm02_00340095 predicted 2421
6 SASI_Mm02_00340096 predicted 1398
7 SASI_Mm02_00340097 predicted 1284
8 SASI_Mm02_00340098 predicted 420
9 SASI_Mm02_00340099 predicted 1969
10 SASI_Mm02_00340100 predicted 1631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144553
VALIDATED
DLGAP5 MISSION shRNA Bacterial Glycerol Stock
discs, large (Drosophila) homolog-associated protein 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-2791s1c1
Sequence:CCGGCATTCAGTGCTCGCCTTTAATCTCGAGATTAAAGGCGAGCACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-800s1c1
Sequence:CCGGGCAGGAATGTTCCTAAAGCAACTCGAGTTGCTTTAGGAACATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-420s1c1
Sequence:CCGGGCGAAACAGACACTTCGGTTTCTCGAGAAACCGAAGTGTCTGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-2120s1c1
Sequence:CCGGCTTCTGAACGTCGTTCTCAAACTCGAGTTTGAGAACGACGTTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-1972s1c1
Sequence:CCGGGCCATAAAGAATGCAATGAAACTCGAGTTTCATTGCATTCTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144553.2-1972s21c1
Sequence:CCGGGCCATAAAGAATGCAATGAAACTCGAGTTTCATTGCATTCTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144553.2-2120s21c1
Sequence:CCGGCTTCTGAACGTCGTTCTCAAACTCGAGTTTGAGAACGACGTTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144553.2-420s21c1
Sequence:CCGGGCGAAACAGACACTTCGGTTTCTCGAGAAACCGAAGTGTCTGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144553.2-800s21c1
Sequence:CCGGGCAGGAATGTTCCTAAAGCAACTCGAGTTGCTTTAGGAACATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144553.2-2791s21c1
Sequence:CCGGCATTCAGTGCTCGCCTTTAATCTCGAGATTAAAGGCGAGCACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144553
VALIDATED
DLGAP5 MISSION shRNA shRNA Plasmid DNA
discs, large (Drosophila) homolog-associated protein 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-2791s1c1
Sequence:CCGGCATTCAGTGCTCGCCTTTAATCTCGAGATTAAAGGCGAGCACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-800s1c1
Sequence:CCGGGCAGGAATGTTCCTAAAGCAACTCGAGTTGCTTTAGGAACATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-420s1c1
Sequence:CCGGGCGAAACAGACACTTCGGTTTCTCGAGAAACCGAAGTGTCTGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-2120s1c1
Sequence:CCGGCTTCTGAACGTCGTTCTCAAACTCGAGTTTGAGAACGACGTTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-1972s1c1
Sequence:CCGGGCCATAAAGAATGCAATGAAACTCGAGTTTCATTGCATTCTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144553.2-1972s21c1
Sequence:CCGGGCCATAAAGAATGCAATGAAACTCGAGTTTCATTGCATTCTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144553.2-2120s21c1
Sequence:CCGGCTTCTGAACGTCGTTCTCAAACTCGAGTTTGAGAACGACGTTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144553.2-420s21c1
Sequence:CCGGGCGAAACAGACACTTCGGTTTCTCGAGAAACCGAAGTGTCTGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144553.2-800s21c1
Sequence:CCGGGCAGGAATGTTCCTAAAGCAACTCGAGTTGCTTTAGGAACATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144553.2-2791s21c1
Sequence:CCGGCATTCAGTGCTCGCCTTTAATCTCGAGATTAAAGGCGAGCACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144553
VALIDATED
DLGAP5 MISSION shRNA Lentiviral Transduction Particles
discs, large (Drosophila) homolog-associated protein 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-2791s1c1
Sequence:CCGGCATTCAGTGCTCGCCTTTAATCTCGAGATTAAAGGCGAGCACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-800s1c1
Sequence:CCGGGCAGGAATGTTCCTAAAGCAACTCGAGTTGCTTTAGGAACATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-420s1c1
Sequence:CCGGGCGAAACAGACACTTCGGTTTCTCGAGAAACCGAAGTGTCTGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-2120s1c1
Sequence:CCGGCTTCTGAACGTCGTTCTCAAACTCGAGTTTGAGAACGACGTTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144553.1-1972s1c1
Sequence:CCGGGCCATAAAGAATGCAATGAAACTCGAGTTTCATTGCATTCTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144553.2-1972s21c1
Sequence:CCGGGCCATAAAGAATGCAATGAAACTCGAGTTTCATTGCATTCTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144553.2-2120s21c1
Sequence:CCGGCTTCTGAACGTCGTTCTCAAACTCGAGTTTGAGAACGACGTTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144553.2-420s21c1
Sequence:CCGGGCGAAACAGACACTTCGGTTTCTCGAGAAACCGAAGTGTCTGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144553.2-800s21c1
Sequence:CCGGGCAGGAATGTTCCTAAAGCAACTCGAGTTGCTTTAGGAACATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144553.2-2791s21c1
Sequence:CCGGCATTCAGTGCTCGCCTTTAATCTCGAGATTAAAGGCGAGCACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014750
VALIDATED
DLGAP5 MISSION shRNA Bacterial Glycerol Stock
discs, large (Drosophila) homolog-associated protein 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014750.3-1620s1c1
Sequence:CCGGGCACAGCAGTTGGTCAAACAACTCGAGTTGTTTGACCAACTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014750.3-2181s1c1
Sequence:CCGGGCATTCCACAACAAACTACATCTCGAGATGTAGTTTGTTGTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014750.3-323s1c1
Sequence:CCGGCATAAGGAATACGAACGAAATCTCGAGATTTCGTTCGTATTCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014750.3-721s1c1
Sequence:CCGGCGAGAGTGATGTTCGAGCAATCTCGAGATTGCTCGAACATCACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014750.3-2636s1c1
Sequence:CCGGCCAGGTCTAAACTGCAGTAATCTCGAGATTACTGCAGTTTAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014750.4-2181s21c1
Sequence:CCGGGCATTCCACAACAAACTACATCTCGAGATGTAGTTTGTTGTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014750.4-2636s21c1
Sequence:CCGGCCAGGTCTAAACTGCAGTAATCTCGAGATTACTGCAGTTTAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_014750.4-323s21c1
Sequence:CCGGCATAAGGAATACGAACGAAATCTCGAGATTTCGTTCGTATTCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014750.4-1620s21c1
Sequence:CCGGGCACAGCAGTTGGTCAAACAACTCGAGTTGTTTGACCAACTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014750.4-721s21c1
Sequence:CCGGCGAGAGTGATGTTCGAGCAATCTCGAGATTGCTCGAACATCACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014750
VALIDATED
DLGAP5 MISSION shRNA shRNA Plasmid DNA
discs, large (Drosophila) homolog-associated protein 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014750.3-1620s1c1
Sequence:CCGGGCACAGCAGTTGGTCAAACAACTCGAGTTGTTTGACCAACTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014750.3-2181s1c1
Sequence:CCGGGCATTCCACAACAAACTACATCTCGAGATGTAGTTTGTTGTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014750.3-323s1c1
Sequence:CCGGCATAAGGAATACGAACGAAATCTCGAGATTTCGTTCGTATTCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014750.3-721s1c1
Sequence:CCGGCGAGAGTGATGTTCGAGCAATCTCGAGATTGCTCGAACATCACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014750.3-2636s1c1
Sequence:CCGGCCAGGTCTAAACTGCAGTAATCTCGAGATTACTGCAGTTTAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014750.4-2181s21c1
Sequence:CCGGGCATTCCACAACAAACTACATCTCGAGATGTAGTTTGTTGTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014750.4-2636s21c1
Sequence:CCGGCCAGGTCTAAACTGCAGTAATCTCGAGATTACTGCAGTTTAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_014750.4-323s21c1
Sequence:CCGGCATAAGGAATACGAACGAAATCTCGAGATTTCGTTCGTATTCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014750.4-1620s21c1
Sequence:CCGGGCACAGCAGTTGGTCAAACAACTCGAGTTGTTTGACCAACTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014750.4-721s21c1
Sequence:CCGGCGAGAGTGATGTTCGAGCAATCTCGAGATTGCTCGAACATCACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014750
VALIDATED
DLGAP5 MISSION shRNA Lentiviral Transduction Particles
discs, large (Drosophila) homolog-associated protein 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014750.3-1620s1c1
Sequence:CCGGGCACAGCAGTTGGTCAAACAACTCGAGTTGTTTGACCAACTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014750.3-2181s1c1
Sequence:CCGGGCATTCCACAACAAACTACATCTCGAGATGTAGTTTGTTGTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014750.3-323s1c1
Sequence:CCGGCATAAGGAATACGAACGAAATCTCGAGATTTCGTTCGTATTCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014750.3-721s1c1
Sequence:CCGGCGAGAGTGATGTTCGAGCAATCTCGAGATTGCTCGAACATCACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014750.3-2636s1c1
Sequence:CCGGCCAGGTCTAAACTGCAGTAATCTCGAGATTACTGCAGTTTAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014750.4-2181s21c1
Sequence:CCGGGCATTCCACAACAAACTACATCTCGAGATGTAGTTTGTTGTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014750.4-2636s21c1
Sequence:CCGGCCAGGTCTAAACTGCAGTAATCTCGAGATTACTGCAGTTTAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_014750.4-323s21c1
Sequence:CCGGCATAAGGAATACGAACGAAATCTCGAGATTTCGTTCGTATTCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014750.4-1620s21c1
Sequence:CCGGGCACAGCAGTTGGTCAAACAACTCGAGTTGTTTGACCAACTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014750.4-721s21c1
Sequence:CCGGCGAGAGTGATGTTCGAGCAATCTCGAGATTGCTCGAACATCACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks