EMAIL THIS PAGE TO A FRIEND

DLK1

delta-like 1 homolog (Drosophila)

104 Gene Product Result for
Synonyms: DLK DLK-1 Delta1 FA1 PREF1 Pref-1 ZOG pG2
UniProtKB ID: P80370, P15803, Q96DW5
Gene ID:
Human(8788) Summary: This gene encodes a transmembrane protein containing six epidermal growth factor repeats. The protein is involved in the differentiation of several cell types, including adipocytes; it is also thought to be a tumor suppressor. It is one of several imprinted genes located in a region of on chr 14q32. Certain mutations in this imprinted region can cause phenotypes similar to maternal and paternal uniparental disomy of chromosome 14 (UPD14). This gene is expressed from the paternal allele. A polymorphism within this gene has been associated with child and adolescent obesity. The mode of inheritance for this polymorphism is polar overdominance; this non-Mendelian inheritance pattern was first described in sheep with the callipyge phenotype, which is characterized by muscle hypertrophy and decreased fat mass. [provided by RefSeq, Mar 2010]
Mouse(13386) delta-like 1 homolog (Drosophila)
Rat(114587) delta-like 1 homolog (Drosophila)
chicken(423459) delta-like 1 homolog (Drosophila)
Horse(100054933) delta-like 1 homolog (Drosophila)
cow(281117) delta-like 1 homolog (Drosophila)
domestic cat(101081814) delta-like 1 homolog (Drosophila)
dog(490860) delta-like 1 homolog (Drosophila)
naked mole-rat(101700819) delta-like 1 homolog (Drosophila)
domestic guinea pig(100719185) delta-like 1 homolog (Drosophila)
Goat(100860802) delta-like 1 homolog (Drosophila)
sheep(101119678) delta-like 1 homolog (Drosophila)
sheep(641301) delta-like 1 homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010052 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010052 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010052 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032997 Rosetta Predictions human pricing
NM_003836 Rosetta Predictions human pricing
NM_053744 Rosetta Predictions rat pricing
XM_579575 Rosetta Predictions rat pricing
NM_010052 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241831 predicted 1067
2 SASI_Hs01_00241832 predicted 540
3 SASI_Hs01_00241833 predicted 1000
4 SASI_Hs01_00241834 predicted 540
5 SASI_Hs01_00241835 predicted 285
6 SASI_Hs01_00241836 predicted 335
7 SASI_Hs01_00241837 predicted 297
8 SASI_Hs01_00241838 predicted 384
9 SASI_Hs01_00241839 predicted 369
10 SASI_Hs01_00241840 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336400 predicted 1120
2 SASI_Hs02_00336401 predicted 1008
3 SASI_Hs01_00049834 predicted 1252
4 SASI_Hs02_00336402 predicted 873
5 SASI_Hs02_00336403 predicted 1150
6 SASI_Hs01_00049839 predicted 304
7 SASI_Hs01_00049841 predicted 355
8 SASI_Hs02_00336404 predicted 631
9 SASI_Hs02_00336405 predicted 994
10 SASI_Hs02_00336406 predicted 638
11 SASI_Hs01_00049835 predicted 507
12 SASI_Hs01_00049836 predicted 1198
13 SASI_Hs01_00049837 predicted 511
14 SASI_Hs01_00049838 predicted 261
15 SASI_Hs01_00049840 predicted 278
16 SASI_Hs01_00049842 predicted 346
17 SASI_Hs01_00049843 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055209 predicted 991
2 SASI_Rn01_00055210 predicted 373
3 SASI_Rn01_00055211 predicted 1094
4 SASI_Rn01_00055212 predicted 1238
5 SASI_Rn01_00055213 predicted 318
6 SASI_Rn01_00055214 predicted 1126
7 SASI_Rn01_00055215 predicted 284
8 SASI_Rn01_00055216 predicted 429
9 SASI_Rn01_00055217 predicted 459
10 SASI_Rn01_00055218 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150735 predicted 997
2 SASI_Rn01_00150736 predicted 381
3 SASI_Rn01_00150737 predicted 383
4 SASI_Rn01_00150738 predicted 1103
5 SASI_Rn01_00150739 predicted 320
6 SASI_Rn01_00150740 predicted 385
7 SASI_Rn01_00150741 predicted 289
8 SASI_Rn01_00150742 predicted 433
9 SASI_Rn01_00150743 predicted 467
10 SASI_Rn01_00150744 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153718 predicted 1004
2 SASI_Mm01_00153719 predicted 634
3 SASI_Mm01_00153720 predicted 469
4 SASI_Mm01_00153721 predicted 472
5 SASI_Mm01_00153722 predicted 354
6 SASI_Mm01_00153723 predicted 389
7 SASI_Mm01_00153724 predicted 828
8 SASI_Mm01_00153725 predicted 398
9 SASI_Mm01_00153726 predicted 733
10 SASI_Mm01_00153727 predicted 640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003836
DLK1 MISSION shRNA Bacterial Glycerol Stock
delta-like 1 homolog (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003836.5-1221s21c1
Sequence:CCGGCAACCACATGCTGCGGAAGAACTCGAGTTCTTCCGCAGCATGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003836.5-1390s21c1
Sequence:CCGGAGTTCCGCAGAGCTTACTATACTCGAGTATAGTAAGCTCTGCGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-1002s1c1
Sequence:CCGGCATCCTGAAGGTGTCCATGAACTCGAGTTCATGGACACCTTCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-873s1c1
Sequence:CCGGAGGTCTCACCTGTGTCAAGAACTCGAGTTCTTGACACAGGTGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-639s1c1
Sequence:CCGGCTCAGGCAATTTCTGCGAGATCTCGAGATCTCGCAGAAATTGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-1254s1c1
Sequence:CCGGGAAGATCGACATGACCACCTTCTCGAGAAGGTGGTCATGTCGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-1227s1c1
Sequence:CCGGCCTGGCCGTCAACATCATCTTCTCGAGAAGATGATGTTGACGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003836
DLK1 MISSION shRNA shRNA Plasmid DNA
delta-like 1 homolog (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003836.5-1221s21c1
Sequence:CCGGCAACCACATGCTGCGGAAGAACTCGAGTTCTTCCGCAGCATGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003836.5-1390s21c1
Sequence:CCGGAGTTCCGCAGAGCTTACTATACTCGAGTATAGTAAGCTCTGCGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-1002s1c1
Sequence:CCGGCATCCTGAAGGTGTCCATGAACTCGAGTTCATGGACACCTTCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-873s1c1
Sequence:CCGGAGGTCTCACCTGTGTCAAGAACTCGAGTTCTTGACACAGGTGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-639s1c1
Sequence:CCGGCTCAGGCAATTTCTGCGAGATCTCGAGATCTCGCAGAAATTGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-1254s1c1
Sequence:CCGGGAAGATCGACATGACCACCTTCTCGAGAAGGTGGTCATGTCGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-1227s1c1
Sequence:CCGGCCTGGCCGTCAACATCATCTTCTCGAGAAGATGATGTTGACGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003836
DLK1 MISSION shRNA Lentiviral Transduction Particles
delta-like 1 homolog (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003836.5-1221s21c1
Sequence:CCGGCAACCACATGCTGCGGAAGAACTCGAGTTCTTCCGCAGCATGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003836.5-1390s21c1
Sequence:CCGGAGTTCCGCAGAGCTTACTATACTCGAGTATAGTAAGCTCTGCGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-1002s1c1
Sequence:CCGGCATCCTGAAGGTGTCCATGAACTCGAGTTCATGGACACCTTCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-873s1c1
Sequence:CCGGAGGTCTCACCTGTGTCAAGAACTCGAGTTCTTGACACAGGTGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-639s1c1
Sequence:CCGGCTCAGGCAATTTCTGCGAGATCTCGAGATCTCGCAGAAATTGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-1254s1c1
Sequence:CCGGGAAGATCGACATGACCACCTTCTCGAGAAGGTGGTCATGTCGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003836.3-1227s1c1
Sequence:CCGGCCTGGCCGTCAACATCATCTTCTCGAGAAGATGATGTTGACGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010052
VALIDATED
DLK1 MISSION shRNA Bacterial Glycerol Stock
delta-like 1 homolog (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010052.4-1171s21c1
Sequence:CCGGCCACATGCTTCGCAAGAAGAACTCGAGTTCTTCTTGCGAAGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010052.4-1283s21c1
Sequence:CCGGGCTGGTGATGAGGAGATCTAACTCGAGTTAGATCTCCTCATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010052.4-1119s21c1
Sequence:CCGGCCATCGTCTTTCTCAACAAGTCTCGAGACTTGTTGAGAAAGACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010052.4-386s21c1
Sequence:CCGGGACGGGAAATTCTGCGAAATACTCGAGTATTTCGCAGAATTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010052.1-1290s1c1
Sequence:CCGGGCTGGTGATGAGGAGATCTAACTCGAGTTAGATCTCCTCATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010052.1-639s1c1
Sequence:CCGGCTCAGGCAACTTCTGTGAGATCTCGAGATCTCACAGAAGTTGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010052.1-1178s1c1
Sequence:CCGGCCACATGCTTCGCAAGAAGAACTCGAGTTCTTCTTGCGAAGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010052.1-394s1c1
Sequence:CCGGGACGGGAAATTCTGCGAAATACTCGAGTATTTCGCAGAATTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010052.1-1126s1c1
Sequence:CCGGCCATCGTCTTTCTCAACAAGTCTCGAGACTTGTTGAGAAAGACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010052
VALIDATED
DLK1 MISSION shRNA shRNA Plasmid DNA
delta-like 1 homolog (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010052.4-1171s21c1
Sequence:CCGGCCACATGCTTCGCAAGAAGAACTCGAGTTCTTCTTGCGAAGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010052.4-1283s21c1
Sequence:CCGGGCTGGTGATGAGGAGATCTAACTCGAGTTAGATCTCCTCATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010052.4-1119s21c1
Sequence:CCGGCCATCGTCTTTCTCAACAAGTCTCGAGACTTGTTGAGAAAGACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010052.4-386s21c1
Sequence:CCGGGACGGGAAATTCTGCGAAATACTCGAGTATTTCGCAGAATTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010052.1-1290s1c1
Sequence:CCGGGCTGGTGATGAGGAGATCTAACTCGAGTTAGATCTCCTCATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010052.1-639s1c1
Sequence:CCGGCTCAGGCAACTTCTGTGAGATCTCGAGATCTCACAGAAGTTGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010052.1-1178s1c1
Sequence:CCGGCCACATGCTTCGCAAGAAGAACTCGAGTTCTTCTTGCGAAGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010052.1-394s1c1
Sequence:CCGGGACGGGAAATTCTGCGAAATACTCGAGTATTTCGCAGAATTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010052.1-1126s1c1
Sequence:CCGGCCATCGTCTTTCTCAACAAGTCTCGAGACTTGTTGAGAAAGACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010052
VALIDATED
DLK1 MISSION shRNA Lentiviral Transduction Particles
delta-like 1 homolog (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010052.4-1171s21c1
Sequence:CCGGCCACATGCTTCGCAAGAAGAACTCGAGTTCTTCTTGCGAAGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010052.4-1283s21c1
Sequence:CCGGGCTGGTGATGAGGAGATCTAACTCGAGTTAGATCTCCTCATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010052.4-1119s21c1
Sequence:CCGGCCATCGTCTTTCTCAACAAGTCTCGAGACTTGTTGAGAAAGACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010052.4-386s21c1
Sequence:CCGGGACGGGAAATTCTGCGAAATACTCGAGTATTTCGCAGAATTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010052.1-1290s1c1
Sequence:CCGGGCTGGTGATGAGGAGATCTAACTCGAGTTAGATCTCCTCATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010052.1-639s1c1
Sequence:CCGGCTCAGGCAACTTCTGTGAGATCTCGAGATCTCACAGAAGTTGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010052.1-1178s1c1
Sequence:CCGGCCACATGCTTCGCAAGAAGAACTCGAGTTCTTCTTGCGAAGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010052.1-394s1c1
Sequence:CCGGGACGGGAAATTCTGCGAAATACTCGAGTATTTCGCAGAATTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010052.1-1126s1c1
Sequence:CCGGCCATCGTCTTTCTCAACAAGTCTCGAGACTTGTTGAGAAAGACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks