EMAIL THIS PAGE TO A FRIEND

DLK2

delta-like 2 homolog (Drosophila)

70 Gene Product Result for
Synonyms: EGFL9
UniProtKB ID: Q6UY11, B3KNZ7, Q5T3T8, Q9BQ54
Gene ID:
Mouse(106565) delta-like 2 homolog (Drosophila)
Rat(316232) delta-like 2 homolog (Drosophila)
sheep(101113181) delta-like 2 homolog (Drosophila)
domestic guinea pig(100733994) delta-like 2 homolog (Drosophila)
naked mole-rat(101713088) delta-like 2 homolog (Drosophila)
Zebrafish(100150992) delta-like 2 homolog (Drosophila)
dog(481814) delta-like 2 homolog (Drosophila)
cow(540262) delta-like 2 homolog (Drosophila)
Horse(100055245) delta-like 2 homolog (Drosophila)
domestic cat(101086808) delta-like 2 homolog (Drosophila)
chicken(428576) delta-like 2 homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023932 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134120 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134120 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134120 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU190621 MISSION® esiRNA esiRNA targeting mouse Dlk2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023932 Rosetta Predictions human pricing
NM_206539 Rosetta Predictions human pricing
NM_001108202 Rosetta Predictions rat pricing
NM_207666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076380 predicted 737
2 SASI_Hs01_00076381 predicted 998
3 SASI_Hs01_00076382 predicted 541
4 SASI_Hs01_00076383 predicted 451
5 SASI_Hs01_00076384 predicted 773
6 SASI_Hs01_00076385 predicted 1059
7 SASI_Hs01_00076386 predicted 1093
8 SASI_Hs01_00076387 predicted 828
9 SASI_Hs02_00356397 predicted 945
10 SASI_Hs02_00356398 predicted 711
11 SASI_Hs01_00076379 predicted 665
12 SASI_Hs01_00076388 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123540 predicted 642
2 SASI_Hs01_00123541 predicted 914
3 SASI_Hs01_00123542 predicted 457
4 SASI_Hs01_00123543 predicted 358
5 SASI_Hs01_00123544 predicted 684
6 SASI_Hs01_00123545 predicted 965
7 SASI_Hs01_00123546 predicted 1000
8 SASI_Hs01_00123547 predicted 738
9 SASI_Hs02_00373514 predicted 849
10 SASI_Hs02_00373515 predicted 619
11 SASI_Hs01_00123539 predicted 573
12 SASI_Hs01_00123548 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236324 predicted 390
2 SASI_Rn02_00236325 predicted 649
3 SASI_Rn02_00236326 predicted 853
4 SASI_Rn02_00236327 predicted 744
5 SASI_Rn02_00236328 predicted 666
6 SASI_Rn02_00236329 predicted 1050
7 SASI_Rn02_00236330 predicted 837
8 SASI_Rn02_00236331 predicted 768
9 SASI_Rn02_00236332 predicted 1176
10 SASI_Rn02_00236333 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352189 predicted 1088
2 SASI_Mm01_00078661 predicted 743
3 SASI_Mm01_00078663 predicted 1053
4 SASI_Mm01_00078664 predicted 443
5 SASI_Mm01_00078665 predicted 924
6 SASI_Mm01_00078666 predicted 756
7 SASI_Mm01_00078667 predicted 1004
8 SASI_Mm01_00078668 predicted 766
9 SASI_Mm01_00078669 predicted 1265
10 SASI_Mm01_00078670 predicted 1083
11 SASI_Mm01_00078662 predicted 1099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023932
DLK2 MISSION shRNA Bacterial Glycerol Stock
delta-like 2 homolog (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-459s1c1
Sequence:CCGGGCAGGCAAGTTCTGTGACAAACTCGAGTTTGTCACAGAACTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-717s1c1
Sequence:CCGGCGCTGTGAGGTAAATGTGGATCTCGAGATCCACATTTACCTCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-769s1c1
Sequence:CCGGCCACCTGCCTTGACGGCATAACTCGAGTTATGCCGTCAAGGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-662s1c1
Sequence:CCGGCCAGGGCTTTGCTCTCAACTTCTCGAGAAGTTGAGAGCAAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-549s1c1
Sequence:CCGGGAGTACCATTGTGTGTGCTTACTCGAGTAAGCACACACAATGGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023932
DLK2 MISSION shRNA shRNA Plasmid DNA
delta-like 2 homolog (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-459s1c1
Sequence:CCGGGCAGGCAAGTTCTGTGACAAACTCGAGTTTGTCACAGAACTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-717s1c1
Sequence:CCGGCGCTGTGAGGTAAATGTGGATCTCGAGATCCACATTTACCTCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-769s1c1
Sequence:CCGGCCACCTGCCTTGACGGCATAACTCGAGTTATGCCGTCAAGGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-662s1c1
Sequence:CCGGCCAGGGCTTTGCTCTCAACTTCTCGAGAAGTTGAGAGCAAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-549s1c1
Sequence:CCGGGAGTACCATTGTGTGTGCTTACTCGAGTAAGCACACACAATGGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023932
DLK2 MISSION shRNA Lentiviral Transduction Particles
delta-like 2 homolog (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-459s1c1
Sequence:CCGGGCAGGCAAGTTCTGTGACAAACTCGAGTTTGTCACAGAACTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-717s1c1
Sequence:CCGGCGCTGTGAGGTAAATGTGGATCTCGAGATCCACATTTACCTCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-769s1c1
Sequence:CCGGCCACCTGCCTTGACGGCATAACTCGAGTTATGCCGTCAAGGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-662s1c1
Sequence:CCGGCCAGGGCTTTGCTCTCAACTTCTCGAGAAGTTGAGAGCAAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023932.2-549s1c1
Sequence:CCGGGAGTACCATTGTGTGTGCTTACTCGAGTAAGCACACACAATGGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134120
DLK2 MISSION shRNA Bacterial Glycerol Stock
delta-like 2 homolog (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000124454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134120.2-1302s1c1
Sequence:CCGGAGGAGCCTTTCTAGCTACCTTCTCGAGAAGGTAGCTAGAAAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134120.2-759s1c1
Sequence:CCGGCCACATGCATTGATGGCATAACTCGAGTTATGCCATCAATGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134120.2-891s1c1
Sequence:CCGGTCCATGACTTTGACTGCCTGTCTCGAGACAGGCAGTCAAAGTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134120.2-1051s1c1
Sequence:CCGGCCTGCTAAGGATCTCAGTGAACTCGAGTTCACTGAGATCCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134120
DLK2 MISSION shRNA shRNA Plasmid DNA
delta-like 2 homolog (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000124454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134120.2-1302s1c1
Sequence:CCGGAGGAGCCTTTCTAGCTACCTTCTCGAGAAGGTAGCTAGAAAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134120.2-759s1c1
Sequence:CCGGCCACATGCATTGATGGCATAACTCGAGTTATGCCATCAATGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134120.2-891s1c1
Sequence:CCGGTCCATGACTTTGACTGCCTGTCTCGAGACAGGCAGTCAAAGTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134120.2-1051s1c1
Sequence:CCGGCCTGCTAAGGATCTCAGTGAACTCGAGTTCACTGAGATCCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134120
DLK2 MISSION shRNA Lentiviral Transduction Particles
delta-like 2 homolog (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000124454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134120.2-1302s1c1
Sequence:CCGGAGGAGCCTTTCTAGCTACCTTCTCGAGAAGGTAGCTAGAAAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134120.2-759s1c1
Sequence:CCGGCCACATGCATTGATGGCATAACTCGAGTTATGCCATCAATGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134120.2-891s1c1
Sequence:CCGGTCCATGACTTTGACTGCCTGTCTCGAGACAGGCAGTCAAAGTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134120.2-1051s1c1
Sequence:CCGGCCTGCTAAGGATCTCAGTGAACTCGAGTTCACTGAGATCCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207666
DLK2 MISSION shRNA Bacterial Glycerol Stock
delta-like 2 homolog (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000437405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207666.2-1103s21c1
Sequence:CCGGAGTCTGGGCTTGGTGAATCTACTCGAGTAGATTCACCAAGCCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207666.2-500s21c1
Sequence:CCGGCACAATCACCCTGCCAGAATGCTCGAGCATTCTGGCAGGGTGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207666.2-1340s21c1
Sequence:CCGGGTAAGACCACAGCGCTGTGATCTCGAGATCACAGCGCTGTGGTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207666.2-725s21c1
Sequence:CCGGAGGTCAATGTGGACGACTGTCCTCGAGGACAGTCGTCCACATTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207666
DLK2 MISSION shRNA shRNA Plasmid DNA
delta-like 2 homolog (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000437405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207666.2-1103s21c1
Sequence:CCGGAGTCTGGGCTTGGTGAATCTACTCGAGTAGATTCACCAAGCCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207666.2-500s21c1
Sequence:CCGGCACAATCACCCTGCCAGAATGCTCGAGCATTCTGGCAGGGTGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207666.2-1340s21c1
Sequence:CCGGGTAAGACCACAGCGCTGTGATCTCGAGATCACAGCGCTGTGGTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207666.2-725s21c1
Sequence:CCGGAGGTCAATGTGGACGACTGTCCTCGAGGACAGTCGTCCACATTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207666
DLK2 MISSION shRNA Lentiviral Transduction Particles
delta-like 2 homolog (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000437405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207666.2-1103s21c1
Sequence:CCGGAGTCTGGGCTTGGTGAATCTACTCGAGTAGATTCACCAAGCCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207666.2-500s21c1
Sequence:CCGGCACAATCACCCTGCCAGAATGCTCGAGCATTCTGGCAGGGTGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207666.2-1340s21c1
Sequence:CCGGGTAAGACCACAGCGCTGTGATCTCGAGATCACAGCGCTGTGGTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207666.2-725s21c1
Sequence:CCGGAGGTCAATGTGGACGACTGTCCTCGAGGACAGTCGTCCACATTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks