EMAIL THIS PAGE TO A FRIEND

DLL1

delta-like 1 (Drosophila)

115 Gene Product Result for
Synonyms: DELTA1 DL1 Delta
UniProtKB ID: O00548, B2RAK7, Q9NU41, Q9UJV2
Gene ID:
Human(28514) Summary: DLL1 is a human homolog of the Notch Delta ligand and is a member of the delta/serrate/jagged family. It plays a role in mediating cell fate decisions during hematopoiesis. It may play a role in cell-to-cell communication. [provided by RefSeq, Jul 2008]
Mouse(13388) delta-like 1 (Drosophila)
Rat(84010) delta-like 1 (Drosophila)
chicken(395820) delta-like 1 (Drosophila)
cow(788775) delta-like 1 (Drosophila)
Horse(100052876) delta-like 1 (Drosophila)
domestic cat(101083683) delta-like 1 (Drosophila)
dog(100688936) delta-like 1 (Drosophila)
naked mole-rat(101698853) delta-like 1 (Drosophila)
domestic guinea pig(100733588) delta-like 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005618 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126621 MISSION® esiRNA esiRNA human DLL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005618 Rosetta Predictions human pricing
NM_032063 Rosetta Predictions rat pricing
NM_007865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104908 predicted 2573
2 SASI_Hs02_00339941 predicted 1663
3 SASI_Hs02_00339942 predicted 1694
4 SASI_Hs01_00104909 predicted 1349
5 SASI_Hs01_00104910 predicted 2621
6 SASI_Hs01_00104913 predicted 2873
7 SASI_Hs01_00104915 predicted 825
8 SASI_Hs01_00104916 predicted 1154
9 SASI_Hs01_00104917 predicted 1350
10 SASI_Hs02_00339943 predicted 2876
11 SASI_Hs01_00104911 predicted 2562
12 SASI_Hs01_00104912 predicted 2935
13 SASI_Hs01_00104914 predicted 2113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032063 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041055 predicted 2412
2 SASI_Rn01_00041056 predicted 2442
3 SASI_Rn01_00041057 predicted 2486
4 SASI_Rn01_00041058 predicted 2053
5 SASI_Rn01_00041059 predicted 799
6 SASI_Rn01_00041060 predicted 621
7 SASI_Rn01_00041061 predicted 1986
8 SASI_Rn01_00041062 predicted 1251
9 SASI_Rn01_00041063 predicted 2103
10 SASI_Rn01_00041064 predicted 1487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161272 predicted 2682
2 SASI_Mm01_00161273 predicted 1458
3 SASI_Mm01_00161274 predicted 2744
4 SASI_Mm01_00161275 predicted 2698
5 SASI_Mm01_00161276 predicted 2654
6 SASI_Mm01_00161277 predicted 1540
7 SASI_Mm01_00161278 predicted 1264
8 SASI_Mm01_00161280 predicted 2808
9 SASI_Mm01_00161281 predicted 2297
10 SASI_Mm02_00312649 predicted 1092
11 SASI_Mm01_00161279 predicted 1537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005618
DLL1 MISSION shRNA Bacterial Glycerol Stock
delta-like 1 (Drosophila)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005618.3-2906s21c1
Sequence:CCGGGGTGAACTGAATTACGCATAACTCGAGTTATGCGTAATTCAGTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-2397s1c1
Sequence:CCGGCTCGGGCTGTTCAACTTCAAACTCGAGTTTGAAGTTGAACAGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-1556s1c1
Sequence:CCGGCCTGTTCTAATGGTGCCAAGTCTCGAGACTTGGCACCATTAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-2439s1c1
Sequence:CCGGGTACGTCATATCCGAGGAGAACTCGAGTTCTCCTCGGATATGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-2196s1c1
Sequence:CCGGCGCCGACAAGAATGGCTTCAACTCGAGTTGAAGCCATTCTTGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-1070s1c1
Sequence:CCGGGCCGGTACTGTGACGAGTGTACTCGAGTACACTCGTCACAGTACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005618
DLL1 MISSION shRNA shRNA Plasmid DNA
delta-like 1 (Drosophila)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005618.3-2906s21c1
Sequence:CCGGGGTGAACTGAATTACGCATAACTCGAGTTATGCGTAATTCAGTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-2397s1c1
Sequence:CCGGCTCGGGCTGTTCAACTTCAAACTCGAGTTTGAAGTTGAACAGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-1556s1c1
Sequence:CCGGCCTGTTCTAATGGTGCCAAGTCTCGAGACTTGGCACCATTAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-2439s1c1
Sequence:CCGGGTACGTCATATCCGAGGAGAACTCGAGTTCTCCTCGGATATGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-2196s1c1
Sequence:CCGGCGCCGACAAGAATGGCTTCAACTCGAGTTGAAGCCATTCTTGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-1070s1c1
Sequence:CCGGGCCGGTACTGTGACGAGTGTACTCGAGTACACTCGTCACAGTACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005618
DLL1 MISSION shRNA Lentiviral Transduction Particles
delta-like 1 (Drosophila)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005618.3-2906s21c1
Sequence:CCGGGGTGAACTGAATTACGCATAACTCGAGTTATGCGTAATTCAGTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-2397s1c1
Sequence:CCGGCTCGGGCTGTTCAACTTCAAACTCGAGTTTGAAGTTGAACAGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-1556s1c1
Sequence:CCGGCCTGTTCTAATGGTGCCAAGTCTCGAGACTTGGCACCATTAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-2439s1c1
Sequence:CCGGGTACGTCATATCCGAGGAGAACTCGAGTTCTCCTCGGATATGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-2196s1c1
Sequence:CCGGCGCCGACAAGAATGGCTTCAACTCGAGTTGAAGCCATTCTTGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005618.2-1070s1c1
Sequence:CCGGGCCGGTACTGTGACGAGTGTACTCGAGTACACTCGTCACAGTACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007865
DLL1 MISSION shRNA Bacterial Glycerol Stock
delta-like 1 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-1040s1c1
Sequence:CCGGCCAACATGGATACTGTGACAACTCGAGTTGTCACAGTATCCATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-1468s1c1
Sequence:CCGGGCTTCAATGGAGGACGATGTTCTCGAGAACATCGTCCTCCATTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-2234s1c1
Sequence:CCGGGAGCAGCTTTAAGGTCCGATACTCGAGTATCGGACCTTAAAGCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-2139s1c1
Sequence:CCGGCGCGAGAAGGACGTTTCTGTTCTCGAGAACAGAAACGTCCTTCTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-1580s1c1
Sequence:CCGGCCCTTGTTCTAACGGTGCCAACTCGAGTTGGCACCGTTAGAACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007865
DLL1 MISSION shRNA shRNA Plasmid DNA
delta-like 1 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-1040s1c1
Sequence:CCGGCCAACATGGATACTGTGACAACTCGAGTTGTCACAGTATCCATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-1468s1c1
Sequence:CCGGGCTTCAATGGAGGACGATGTTCTCGAGAACATCGTCCTCCATTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-2234s1c1
Sequence:CCGGGAGCAGCTTTAAGGTCCGATACTCGAGTATCGGACCTTAAAGCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-2139s1c1
Sequence:CCGGCGCGAGAAGGACGTTTCTGTTCTCGAGAACAGAAACGTCCTTCTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-1580s1c1
Sequence:CCGGCCCTTGTTCTAACGGTGCCAACTCGAGTTGGCACCGTTAGAACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007865
DLL1 MISSION shRNA Lentiviral Transduction Particles
delta-like 1 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-1040s1c1
Sequence:CCGGCCAACATGGATACTGTGACAACTCGAGTTGTCACAGTATCCATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-1468s1c1
Sequence:CCGGGCTTCAATGGAGGACGATGTTCTCGAGAACATCGTCCTCCATTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-2234s1c1
Sequence:CCGGGAGCAGCTTTAAGGTCCGATACTCGAGTATCGGACCTTAAAGCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-2139s1c1
Sequence:CCGGCGCGAGAAGGACGTTTCTGTTCTCGAGAACAGAAACGTCCTTCTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007865.2-1580s1c1
Sequence:CCGGCCCTTGTTCTAACGGTGCCAACTCGAGTTGGCACCGTTAGAACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks