EMAIL THIS PAGE TO A FRIEND

DLL3

delta-like 3 (Drosophila)

100 Gene Product Result for
Synonyms: SCDO1
UniProtKB ID: Q9NYJ7, E9PFG2, Q8NBS4
Gene ID:
Human(10683) Summary: This gene encodes a member of the delta protein ligand family. This family functions as Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. Mutations in this gene cause autosomal recessive spondylocostal dysostosis 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(13389) delta-like 3 (Drosophila)
Rat(114125) delta-like 3 (Drosophila)
sheep(101116337) delta-like 3 (Drosophila)
Domestic Rabbit(100339893) delta-like 3 (Drosophila)
domestic guinea pig(100733678) delta-like 3 (Drosophila)
naked mole-rat(101725599) delta-like 3 (Drosophila)
dog(484508) delta-like 3 (Drosophila)
cow(505993) delta-like 3 (Drosophila)
domestic cat(101095456) delta-like 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016941 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU065071 MISSION® esiRNA esiRNA targeting mouse Dll3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016941 Rosetta Predictions human pricing
NM_203486 Rosetta Predictions human pricing
NM_053666 Rosetta Predictions rat pricing
NM_007866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349935 predicted 1766
2 SASI_Hs02_00349936 predicted 2120
3 SASI_Hs02_00349937 predicted 1750
4 SASI_Hs02_00349938 predicted 2031
5 SASI_Hs02_00349939 predicted 2116
6 SASI_Hs02_00349940 predicted 1750
7 SASI_Hs02_00349941 predicted 1897
8 SASI_Hs02_00349942 predicted 1912
9 SASI_Hs02_00349943 predicted 1762
10 SASI_Hs02_00349944 predicted 1741
11 SASI_Hs01_00232032 predicted 406
12 SASI_Hs01_00232033 predicted 702
13 SASI_Hs01_00232034 predicted 734
14 SASI_Hs01_00232035 predicted 350
15 SASI_Hs01_00232036 predicted 1054
16 SASI_Hs01_00232037 predicted 1558
17 SASI_Hs01_00232038 predicted 1402
18 SASI_Hs01_00232039 predicted 900
19 SASI_Hs01_00232040 predicted 416
20 SASI_Hs01_00232041 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373409 predicted 1768
2 SASI_Hs02_00373410 predicted 1751
3 SASI_Hs01_00199247 predicted 725
4 SASI_Hs01_00199248 predicted 754
5 SASI_Hs02_00373411 predicted 1764
6 SASI_Hs02_00373412 predicted 1738
7 SASI_Hs01_00199251 predicted 1575
8 SASI_Hs01_00199252 predicted 1425
9 SASI_Hs01_00199253 predicted 921
10 SASI_Hs01_00199254 predicted 446
11 SASI_Hs01_00199246 predicted 414
12 SASI_Hs01_00199249 predicted 342
13 SASI_Hs01_00199250 predicted 1054
14 SASI_Hs01_00199255 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106367 predicted 991
2 SASI_Rn01_00106368 predicted 1001
3 SASI_Rn01_00106369 predicted 1648
4 SASI_Rn01_00106370 predicted 1053
5 SASI_Rn01_00106371 predicted 630
6 SASI_Rn01_00106372 predicted 717
7 SASI_Rn01_00106373 predicted 1580
8 SASI_Rn01_00106374 predicted 663
9 SASI_Rn01_00106375 predicted 708
10 SASI_Rn01_00106376 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119813 predicted 1897
2 SASI_Mm02_00312650 predicted 1001
3 SASI_Mm01_00119814 predicted 519
4 SASI_Mm01_00119815 predicted 1655
5 SASI_Mm01_00119816 predicted 1487
6 SASI_Mm02_00312651 predicted 343
7 SASI_Mm02_00312652 predicted 860
8 SASI_Mm01_00119818 predicted 1906
9 SASI_Mm01_00119819 predicted 1889
10 SASI_Mm01_00119820 predicted 532
11 SASI_Mm01_00119817 predicted 1836
12 SASI_Mm01_00119821 predicted 1947
13 SASI_Mm01_00119822 predicted 1637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016941
VALIDATED
DLL3 MISSION shRNA Bacterial Glycerol Stock
delta-like 3 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016941.2-1863s1c1
Sequence:CCGGCCTCGATTCTGTCCGTGAAATCTCGAGATTTCACGGACAGAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016941.2-65s1c1
Sequence:CCGGACTGTGATCCTAGCGCTCATTCTCGAGAATGAGCGCTAGGATCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016941.2-413s1c1
Sequence:CCGGGAGGAGTTAGGAGACCAGATTCTCGAGAATCTGGTCTCCTAACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016941.2-1709s1c1
Sequence:CCGGGTAGATTGGAATCGCCCTGAACTCGAGTTCAGGGCGATTCCAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016941.2-1650s1c1
Sequence:CCGGCGGATGCACTCAACAACCTAACTCGAGTTAGGTTGTTGAGTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016941.3-149s21c1
Sequence:CCGGGAGCTGCAGATCCACTCTTTCCTCGAGGAAAGAGTGGATCTGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016941.3-2124s21c1
Sequence:CCGGTCTAATGCTTCCTACTCATTTCTCGAGAAATGAGTAGGAAGCATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016941.3-1680s21c1
Sequence:CCGGCGGATGCACTCAACAACCTAACTCGAGTTAGGTTGTTGAGTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016941.3-1764s21c1
Sequence:CCGGTAGACCCTCAAGGGATTTATGCTCGAGCATAAATCCCTTGAGGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016941.3-747s21c1
Sequence:CCGGTCTGTGAACAGCCCGGTGAATCTCGAGATTCACCGGGCTGTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016941
VALIDATED
DLL3 MISSION shRNA shRNA Plasmid DNA
delta-like 3 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016941.2-1863s1c1
Sequence:CCGGCCTCGATTCTGTCCGTGAAATCTCGAGATTTCACGGACAGAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016941.2-65s1c1
Sequence:CCGGACTGTGATCCTAGCGCTCATTCTCGAGAATGAGCGCTAGGATCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016941.2-413s1c1
Sequence:CCGGGAGGAGTTAGGAGACCAGATTCTCGAGAATCTGGTCTCCTAACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016941.2-1709s1c1
Sequence:CCGGGTAGATTGGAATCGCCCTGAACTCGAGTTCAGGGCGATTCCAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016941.2-1650s1c1
Sequence:CCGGCGGATGCACTCAACAACCTAACTCGAGTTAGGTTGTTGAGTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016941.3-149s21c1
Sequence:CCGGGAGCTGCAGATCCACTCTTTCCTCGAGGAAAGAGTGGATCTGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016941.3-2124s21c1
Sequence:CCGGTCTAATGCTTCCTACTCATTTCTCGAGAAATGAGTAGGAAGCATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016941.3-1680s21c1
Sequence:CCGGCGGATGCACTCAACAACCTAACTCGAGTTAGGTTGTTGAGTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016941.3-1764s21c1
Sequence:CCGGTAGACCCTCAAGGGATTTATGCTCGAGCATAAATCCCTTGAGGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016941.3-747s21c1
Sequence:CCGGTCTGTGAACAGCCCGGTGAATCTCGAGATTCACCGGGCTGTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016941
VALIDATED
DLL3 MISSION shRNA Lentiviral Transduction Particles
delta-like 3 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016941.2-1863s1c1
Sequence:CCGGCCTCGATTCTGTCCGTGAAATCTCGAGATTTCACGGACAGAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016941.2-65s1c1
Sequence:CCGGACTGTGATCCTAGCGCTCATTCTCGAGAATGAGCGCTAGGATCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016941.2-413s1c1
Sequence:CCGGGAGGAGTTAGGAGACCAGATTCTCGAGAATCTGGTCTCCTAACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016941.2-1709s1c1
Sequence:CCGGGTAGATTGGAATCGCCCTGAACTCGAGTTCAGGGCGATTCCAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016941.2-1650s1c1
Sequence:CCGGCGGATGCACTCAACAACCTAACTCGAGTTAGGTTGTTGAGTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016941.3-149s21c1
Sequence:CCGGGAGCTGCAGATCCACTCTTTCCTCGAGGAAAGAGTGGATCTGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016941.3-2124s21c1
Sequence:CCGGTCTAATGCTTCCTACTCATTTCTCGAGAAATGAGTAGGAAGCATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016941.3-1680s21c1
Sequence:CCGGCGGATGCACTCAACAACCTAACTCGAGTTAGGTTGTTGAGTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016941.3-1764s21c1
Sequence:CCGGTAGACCCTCAAGGGATTTATGCTCGAGCATAAATCCCTTGAGGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016941.3-747s21c1
Sequence:CCGGTCTGTGAACAGCCCGGTGAATCTCGAGATTCACCGGGCTGTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007866
DLL3 MISSION shRNA Bacterial Glycerol Stock
delta-like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-1817s1c1
Sequence:CCGGGACTGGAATCATCCTGAAGATCTCGAGATCTTCAGGATGATTCCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-1763s1c1
Sequence:CCGGCTCAACAACCTGAGGTTACAACTCGAGTTGTAACCTCAGGTTGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-1870s1c1
Sequence:CCGGCCCTTCCATTTATGCACGAGACTCGAGTCTCGTGCATAAATGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-1168s1c1
Sequence:CCGGCCAAGGCTCTAACTGTGAGAACTCGAGTTCTCACAGTTAGAGCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-223s1c1
Sequence:CCGGCGAGCTACAAATTCATTCTTTCTCGAGAAAGAATGAATTTGTAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007866
DLL3 MISSION shRNA shRNA Plasmid DNA
delta-like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-1817s1c1
Sequence:CCGGGACTGGAATCATCCTGAAGATCTCGAGATCTTCAGGATGATTCCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-1763s1c1
Sequence:CCGGCTCAACAACCTGAGGTTACAACTCGAGTTGTAACCTCAGGTTGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-1870s1c1
Sequence:CCGGCCCTTCCATTTATGCACGAGACTCGAGTCTCGTGCATAAATGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-1168s1c1
Sequence:CCGGCCAAGGCTCTAACTGTGAGAACTCGAGTTCTCACAGTTAGAGCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-223s1c1
Sequence:CCGGCGAGCTACAAATTCATTCTTTCTCGAGAAAGAATGAATTTGTAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007866
DLL3 MISSION shRNA Lentiviral Transduction Particles
delta-like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-1817s1c1
Sequence:CCGGGACTGGAATCATCCTGAAGATCTCGAGATCTTCAGGATGATTCCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-1763s1c1
Sequence:CCGGCTCAACAACCTGAGGTTACAACTCGAGTTGTAACCTCAGGTTGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-1870s1c1
Sequence:CCGGCCCTTCCATTTATGCACGAGACTCGAGTCTCGTGCATAAATGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-1168s1c1
Sequence:CCGGCCAAGGCTCTAACTGTGAGAACTCGAGTTCTCACAGTTAGAGCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007866.1-223s1c1
Sequence:CCGGCGAGCTACAAATTCATTCTTTCTCGAGAAAGAATGAATTTGTAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks