EMAIL THIS PAGE TO A FRIEND

DLL4

delta-like 4 (Drosophila)

141 Gene Product Result for
Synonyms: hdelta2
UniProtKB ID: Q9NR61, Q3KP23, Q9NQT9
Gene ID:
Human(54567) Summary: This gene is a homolog of the Drosophila delta gene. The delta gene family encodes Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. [provided by RefSeq, Jul 2008]
Mouse(54485) delta-like 4 (Drosophila)
Rat(311332) delta-like 4 (Drosophila)
Zebrafish(563920) delta-like 4 (Drosophila)
cow(518746) delta-like 4 (Drosophila)
Horse(100057073) delta-like 4 (Drosophila)
domestic cat(101086978) delta-like 4 (Drosophila)
dog(607575) delta-like 4 (Drosophila)
chicken(423208) delta-like 4 (Drosophila)
naked mole-rat(101721317) delta-like 4 (Drosophila)
domestic guinea pig(100731494) delta-like 4 (Drosophila)
sheep(780478) delta-like 4 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019074 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019074 Rosetta Predictions human pricing
NM_001107760 Rosetta Predictions rat pricing
NM_019454 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352665 predicted 2211
2 SASI_Hs01_00174509 predicted 2357
3 SASI_Hs01_00174510 predicted 802
4 SASI_Hs02_00352666 predicted 780
5 SASI_Hs01_00174511 predicted 889
6 SASI_Hs01_00174512 predicted 989
7 SASI_Hs01_00174513 predicted 1468
8 SASI_Hs01_00174514 predicted 2010
9 SASI_Hs02_00352667 predicted 982
10 SASI_Hs01_00174515 predicted 2221
11 SASI_Hs01_00174516 predicted 911
12 SASI_Hs01_00174517 predicted 2371
13 SASI_Hs01_00174518 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231995 predicted 481
2 SASI_Rn02_00231996 predicted 1812
3 SASI_Rn02_00231997 predicted 960
4 SASI_Rn02_00231998 predicted 1319
5 SASI_Rn02_00231999 predicted 1410
6 SASI_Rn02_00232000 predicted 804
7 SASI_Rn02_00232001 predicted 2064
8 SASI_Rn02_00232002 predicted 538
9 SASI_Rn02_00232003 predicted 2010
10 SASI_Rn02_00232004 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092620 predicted 2428
2 SASI_Mm01_00092621 predicted 2361
3 SASI_Mm01_00092623 predicted 2116
4 SASI_Mm01_00092624 predicted 982
5 SASI_Mm01_00092625 predicted 487
6 SASI_Mm01_00092626 predicted 2437
7 SASI_Mm01_00092627 predicted 1231
8 SASI_Mm01_00092628 predicted 1639
9 SASI_Mm02_00324440 predicted 1824
10 SASI_Mm01_00092629 predicted 540
11 SASI_Mm01_00092622 predicted 2347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019074
DLL4 MISSION shRNA Bacterial Glycerol Stock
delta-like 4 (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019074.2-2149s21c1
Sequence:CCGGACCACACATTGGACTATAATCCTCGAGGATTATAGTCCAATGTGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019074.2-2276s21c1
Sequence:CCGGGTGTCGGATATCAGCGATATGCTCGAGCATATCGCTGATATCCGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-821s1c1
Sequence:CCGGGCGCTACTCTTACCGGGTCATCTCGAGATGACCCGGTAAGAGTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-876s1c1
Sequence:CCGGCGCCTGTGCAAGAAGCGCAATCTCGAGATTGCGCTTCTTGCACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-625s1c1
Sequence:CCGGCTCTCCAACTGCCCTTCAATTCTCGAGAATTGAAGGGCAGTTGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-2248s1c1
Sequence:CCGGCACTGCGGTTACACAGTGAAACTCGAGTTTCACTGTGTAACCGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-1829s1c1
Sequence:CCGGCTTTGTGTGCAACTGCCCTTACTCGAGTAAGGGCAGTTGCACACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019074
DLL4 MISSION shRNA shRNA Plasmid DNA
delta-like 4 (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019074.2-2149s21c1
Sequence:CCGGACCACACATTGGACTATAATCCTCGAGGATTATAGTCCAATGTGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019074.2-2276s21c1
Sequence:CCGGGTGTCGGATATCAGCGATATGCTCGAGCATATCGCTGATATCCGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-821s1c1
Sequence:CCGGGCGCTACTCTTACCGGGTCATCTCGAGATGACCCGGTAAGAGTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-876s1c1
Sequence:CCGGCGCCTGTGCAAGAAGCGCAATCTCGAGATTGCGCTTCTTGCACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-625s1c1
Sequence:CCGGCTCTCCAACTGCCCTTCAATTCTCGAGAATTGAAGGGCAGTTGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-2248s1c1
Sequence:CCGGCACTGCGGTTACACAGTGAAACTCGAGTTTCACTGTGTAACCGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-1829s1c1
Sequence:CCGGCTTTGTGTGCAACTGCCCTTACTCGAGTAAGGGCAGTTGCACACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019074
DLL4 MISSION shRNA Lentiviral Transduction Particles
delta-like 4 (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019074.2-2149s21c1
Sequence:CCGGACCACACATTGGACTATAATCCTCGAGGATTATAGTCCAATGTGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019074.2-2276s21c1
Sequence:CCGGGTGTCGGATATCAGCGATATGCTCGAGCATATCGCTGATATCCGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-821s1c1
Sequence:CCGGGCGCTACTCTTACCGGGTCATCTCGAGATGACCCGGTAAGAGTAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-876s1c1
Sequence:CCGGCGCCTGTGCAAGAAGCGCAATCTCGAGATTGCGCTTCTTGCACAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-625s1c1
Sequence:CCGGCTCTCCAACTGCCCTTCAATTCTCGAGAATTGAAGGGCAGTTGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-2248s1c1
Sequence:CCGGCACTGCGGTTACACAGTGAAACTCGAGTTTCACTGTGTAACCGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019074.2-1829s1c1
Sequence:CCGGCTTTGTGTGCAACTGCCCTTACTCGAGTAAGGGCAGTTGCACACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019454
DLL4 MISSION shRNA Bacterial Glycerol Stock
delta-like 4 (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000028894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019454.1-2139s1c1
Sequence:CCGGGCAGAACCACACATTGGACTACTCGAGTAGTCCAATGTGTGGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019454.1-476s1c1
Sequence:CCGGGCCGGACTTTCTTCCGCATTTCTCGAGAAATGCGGAAGAAAGTCCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019454.1-1815s1c1
Sequence:CCGGCCCAAACAACTTCGTCTGCAACTCGAGTTGCAGACGAAGTTGTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019454.1-889s1c1
Sequence:CCGGGATGACCACTTCGGACATTATCTCGAGATAATGTCCGAAGTGGTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019454
DLL4 MISSION shRNA shRNA Plasmid DNA
delta-like 4 (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000028894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019454.1-2139s1c1
Sequence:CCGGGCAGAACCACACATTGGACTACTCGAGTAGTCCAATGTGTGGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019454.1-476s1c1
Sequence:CCGGGCCGGACTTTCTTCCGCATTTCTCGAGAAATGCGGAAGAAAGTCCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019454.1-1815s1c1
Sequence:CCGGCCCAAACAACTTCGTCTGCAACTCGAGTTGCAGACGAAGTTGTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019454.1-889s1c1
Sequence:CCGGGATGACCACTTCGGACATTATCTCGAGATAATGTCCGAAGTGGTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019454
DLL4 MISSION shRNA Lentiviral Transduction Particles
delta-like 4 (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000028894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019454.1-2139s1c1
Sequence:CCGGGCAGAACCACACATTGGACTACTCGAGTAGTCCAATGTGTGGTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019454.1-476s1c1
Sequence:CCGGGCCGGACTTTCTTCCGCATTTCTCGAGAAATGCGGAAGAAAGTCCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019454.1-1815s1c1
Sequence:CCGGCCCAAACAACTTCGTCTGCAACTCGAGTTGCAGACGAAGTTGTTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019454.1-889s1c1
Sequence:CCGGGATGACCACTTCGGACATTATCTCGAGATAATGTCCGAAGTGGTCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)