EMAIL THIS PAGE TO A FRIEND

DLST

dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)

82 Gene Product Result for
Synonyms: DLTS
UniProtKB ID: P36957, Q7LDY7, Q9BQ32
Gene ID:
Human(1743) Summary: This gene encodes a mitochondrial protein that belongs to the 2-oxoacid dehydrogenase family. This protein is one of the three components (the E2 component) of the 2-oxoglutarate dehydrogenase complex that catalyzes the overall conversion of 2-oxoglutarate to succinyl-CoA and CO(2). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(78920) dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
Rat(299201) dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
Zebrafish(368262) dihydrolipoamide S-succinyltransferase
chicken(423357) dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
cow(506888) dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
domestic cat(101095266) dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
dog(480388) dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
sheep(101108658) dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
domestic guinea pig(100734170) dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
naked mole-rat(101696795) dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001933 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001933 Rosetta Predictions human pricing
NM_001006981 Rosetta Predictions rat pricing
NM_030225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176880 predicted 1102
2 SASI_Hs01_00176881 predicted 1138
3 SASI_Hs01_00176882 predicted 346
4 SASI_Hs01_00176883 predicted 856
5 SASI_Hs01_00176884 predicted 383
6 SASI_Hs02_00332834 predicted 1054
7 SASI_Hs01_00176885 predicted 1030
8 SASI_Hs01_00176886 predicted 971
9 SASI_Hs01_00176887 predicted 1031
10 SASI_Hs01_00176889 predicted 931
11 SASI_Hs01_00176888 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054152 predicted 392
2 SASI_Rn01_00054154 predicted 819
3 SASI_Rn01_00054155 predicted 869
4 SASI_Rn01_00054156 predicted 459
5 SASI_Rn01_00054157 predicted 1110
6 SASI_Rn02_00198550 predicted 312
7 SASI_Rn02_00198551 predicted 272
8 SASI_Rn01_00054158 predicted 794
9 SASI_Rn01_00054159 predicted 1076
10 SASI_Rn02_00198552 predicted 457
11 SASI_Rn01_00054151 predicted 1390
12 SASI_Rn01_00054153 predicted 625
13 SASI_Rn01_00054160 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076621 predicted 306
2 SASI_Mm02_00336667 predicted 1049
3 SASI_Mm01_00076622 predicted 729
4 SASI_Mm01_00076623 predicted 1244
5 SASI_Mm01_00076624 predicted 1381
6 SASI_Mm01_00076625 predicted 754
7 SASI_Mm01_00076626 predicted 1227
8 SASI_Mm01_00076627 predicted 1261
9 SASI_Mm01_00076628 predicted 231
10 SASI_Mm01_00076630 predicted 913
11 SASI_Mm01_00076629 predicted 652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001933
VALIDATED
DLST MISSION shRNA Bacterial Glycerol Stock
dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-923s1c1
Sequence:CCGGGCCTGTTGTAAATGCAGTGATCTCGAGATCACTGCATTTACAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-1101s1c1
Sequence:CCGGCGAAAGAATGAACTTGCCATTCTCGAGAATGGCAAGTTCATTCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-1174s1c1
Sequence:CCGGCGCTCTTTGGAACACCCATTACTCGAGTAATGGGTGTTCCAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-390s1c1
Sequence:CCGGCCAGCAAATGGCGTGATTGAACTCGAGTTCAATCACGCCATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-696s1c1
Sequence:CCGGCGTTCAGAACATCGGGAGAAACTCGAGTTTCTCCCGATGTTCTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.3-390s21c1
Sequence:CCGGCCAGCAAATGGCGTGATTGAACTCGAGTTCAATCACGCCATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.3-1101s21c1
Sequence:CCGGCGAAAGAATGAACTTGCCATTCTCGAGAATGGCAAGTTCATTCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.3-923s21c1
Sequence:CCGGGCCTGTTGTAAATGCAGTGATCTCGAGATCACTGCATTTACAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001933.3-696s21c1
Sequence:CCGGCGTTCAGAACATCGGGAGAAACTCGAGTTTCTCCCGATGTTCTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.3-1174s21c1
Sequence:CCGGCGCTCTTTGGAACACCCATTACTCGAGTAATGGGTGTTCCAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001933.4-1740s21c1
Sequence:CCGGCCCTAGTGCTGGTATACTATACTCGAGTATAGTATACCAGCACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.4-895s21c1
Sequence:CCGGCTAGGCTTCATGTCGGCATTTCTCGAGAAATGCCGACATGAAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001933
VALIDATED
DLST MISSION shRNA shRNA Plasmid DNA
dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-923s1c1
Sequence:CCGGGCCTGTTGTAAATGCAGTGATCTCGAGATCACTGCATTTACAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-1101s1c1
Sequence:CCGGCGAAAGAATGAACTTGCCATTCTCGAGAATGGCAAGTTCATTCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-1174s1c1
Sequence:CCGGCGCTCTTTGGAACACCCATTACTCGAGTAATGGGTGTTCCAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-390s1c1
Sequence:CCGGCCAGCAAATGGCGTGATTGAACTCGAGTTCAATCACGCCATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-696s1c1
Sequence:CCGGCGTTCAGAACATCGGGAGAAACTCGAGTTTCTCCCGATGTTCTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.3-390s21c1
Sequence:CCGGCCAGCAAATGGCGTGATTGAACTCGAGTTCAATCACGCCATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.3-1101s21c1
Sequence:CCGGCGAAAGAATGAACTTGCCATTCTCGAGAATGGCAAGTTCATTCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.3-923s21c1
Sequence:CCGGGCCTGTTGTAAATGCAGTGATCTCGAGATCACTGCATTTACAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001933.3-696s21c1
Sequence:CCGGCGTTCAGAACATCGGGAGAAACTCGAGTTTCTCCCGATGTTCTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.3-1174s21c1
Sequence:CCGGCGCTCTTTGGAACACCCATTACTCGAGTAATGGGTGTTCCAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001933.4-1740s21c1
Sequence:CCGGCCCTAGTGCTGGTATACTATACTCGAGTATAGTATACCAGCACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.4-895s21c1
Sequence:CCGGCTAGGCTTCATGTCGGCATTTCTCGAGAAATGCCGACATGAAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001933
VALIDATED
DLST MISSION shRNA Lentiviral Transduction Particles
dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-923s1c1
Sequence:CCGGGCCTGTTGTAAATGCAGTGATCTCGAGATCACTGCATTTACAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-1101s1c1
Sequence:CCGGCGAAAGAATGAACTTGCCATTCTCGAGAATGGCAAGTTCATTCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-1174s1c1
Sequence:CCGGCGCTCTTTGGAACACCCATTACTCGAGTAATGGGTGTTCCAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-390s1c1
Sequence:CCGGCCAGCAAATGGCGTGATTGAACTCGAGTTCAATCACGCCATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001933.3-696s1c1
Sequence:CCGGCGTTCAGAACATCGGGAGAAACTCGAGTTTCTCCCGATGTTCTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.3-390s21c1
Sequence:CCGGCCAGCAAATGGCGTGATTGAACTCGAGTTCAATCACGCCATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.3-1101s21c1
Sequence:CCGGCGAAAGAATGAACTTGCCATTCTCGAGAATGGCAAGTTCATTCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.3-923s21c1
Sequence:CCGGGCCTGTTGTAAATGCAGTGATCTCGAGATCACTGCATTTACAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001933.3-696s21c1
Sequence:CCGGCGTTCAGAACATCGGGAGAAACTCGAGTTTCTCCCGATGTTCTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.3-1174s21c1
Sequence:CCGGCGCTCTTTGGAACACCCATTACTCGAGTAATGGGTGTTCCAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001933.4-1740s21c1
Sequence:CCGGCCCTAGTGCTGGTATACTATACTCGAGTATAGTATACCAGCACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001933.4-895s21c1
Sequence:CCGGCTAGGCTTCATGTCGGCATTTCTCGAGAAATGCCGACATGAAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030225
VALIDATED
DLST MISSION shRNA Bacterial Glycerol Stock
dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030225.3-745s1c1
Sequence:CCGGGCTGACGACTTTCAATGAGGTCTCGAGACCTCATTGAAAGTCGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030225.3-769s1c1
Sequence:CCGGCATGAGTAACATACAAGAGATCTCGAGATCTCTTGTATGTTACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030225.3-1608s1c1
Sequence:CCGGGCCTTAATGGATGCTCATTAACTCGAGTTAATGAGCATCCATTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030225.3-1037s1c1
Sequence:CCGGCGGACCATTAATGAACTAGGACTCGAGTCCTAGTTCATTAATGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030225.3-1025s1c1
Sequence:CCGGGCAGATATTGAACGGACCATTCTCGAGAATGGTCCGTTCAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030225.3-1066s1c1
Sequence:CCGGCCGGAAGAATGAACTTGCCATCTCGAGATGGCAAGTTCATTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030225.3-769s21c1
Sequence:CCGGCATGAGTAACATACAAGAGATCTCGAGATCTCTTGTATGTTACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030225.3-929s1c1
Sequence:CCGGGTGGTGTATAGAGATTATATTCTCGAGAATATAATCTCTATACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030225.3-133s1c1
Sequence:CCGGCAACAGGAAGATGGTCATTAACTCGAGTTAATGACCATCTTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030225.3-1676s21c1
Sequence:CCGGTCCAGTAACAGTATGCTATAGCTCGAGCTATAGCATACTGTTACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030225.3-1025s21c1
Sequence:CCGGGCAGATATTGAACGGACCATTCTCGAGAATGGTCCGTTCAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030225.3-1345s21c1
Sequence:CCGGAGTCCTCCTCCTAGACCTTTACTCGAGTAAAGGTCTAGGAGGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030225.3-132s21c1
Sequence:CCGGACAACAGGAAGATGGTCATTACTCGAGTAATGACCATCTTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030225
VALIDATED
DLST MISSION shRNA shRNA Plasmid DNA
dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030225.3-745s1c1
Sequence:CCGGGCTGACGACTTTCAATGAGGTCTCGAGACCTCATTGAAAGTCGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030225.3-769s1c1
Sequence:CCGGCATGAGTAACATACAAGAGATCTCGAGATCTCTTGTATGTTACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030225.3-1608s1c1
Sequence:CCGGGCCTTAATGGATGCTCATTAACTCGAGTTAATGAGCATCCATTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030225.3-1037s1c1
Sequence:CCGGCGGACCATTAATGAACTAGGACTCGAGTCCTAGTTCATTAATGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030225.3-1025s1c1
Sequence:CCGGGCAGATATTGAACGGACCATTCTCGAGAATGGTCCGTTCAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030225.3-1066s1c1
Sequence:CCGGCCGGAAGAATGAACTTGCCATCTCGAGATGGCAAGTTCATTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030225.3-769s21c1
Sequence:CCGGCATGAGTAACATACAAGAGATCTCGAGATCTCTTGTATGTTACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030225.3-929s1c1
Sequence:CCGGGTGGTGTATAGAGATTATATTCTCGAGAATATAATCTCTATACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030225.3-133s1c1
Sequence:CCGGCAACAGGAAGATGGTCATTAACTCGAGTTAATGACCATCTTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030225.3-1676s21c1
Sequence:CCGGTCCAGTAACAGTATGCTATAGCTCGAGCTATAGCATACTGTTACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030225.3-1025s21c1
Sequence:CCGGGCAGATATTGAACGGACCATTCTCGAGAATGGTCCGTTCAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030225.3-1345s21c1
Sequence:CCGGAGTCCTCCTCCTAGACCTTTACTCGAGTAAAGGTCTAGGAGGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030225.3-132s21c1
Sequence:CCGGACAACAGGAAGATGGTCATTACTCGAGTAATGACCATCTTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030225
VALIDATED
DLST MISSION shRNA Lentiviral Transduction Particles
dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030225.3-745s1c1
Sequence:CCGGGCTGACGACTTTCAATGAGGTCTCGAGACCTCATTGAAAGTCGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030225.3-769s1c1
Sequence:CCGGCATGAGTAACATACAAGAGATCTCGAGATCTCTTGTATGTTACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030225.3-1608s1c1
Sequence:CCGGGCCTTAATGGATGCTCATTAACTCGAGTTAATGAGCATCCATTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030225.3-1037s1c1
Sequence:CCGGCGGACCATTAATGAACTAGGACTCGAGTCCTAGTTCATTAATGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030225.3-1025s1c1
Sequence:CCGGGCAGATATTGAACGGACCATTCTCGAGAATGGTCCGTTCAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030225.3-1066s1c1
Sequence:CCGGCCGGAAGAATGAACTTGCCATCTCGAGATGGCAAGTTCATTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030225.3-769s21c1
Sequence:CCGGCATGAGTAACATACAAGAGATCTCGAGATCTCTTGTATGTTACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030225.3-929s1c1
Sequence:CCGGGTGGTGTATAGAGATTATATTCTCGAGAATATAATCTCTATACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030225.3-133s1c1
Sequence:CCGGCAACAGGAAGATGGTCATTAACTCGAGTTAATGACCATCTTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030225.3-1676s21c1
Sequence:CCGGTCCAGTAACAGTATGCTATAGCTCGAGCTATAGCATACTGTTACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030225.3-1025s21c1
Sequence:CCGGGCAGATATTGAACGGACCATTCTCGAGAATGGTCCGTTCAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030225.3-1345s21c1
Sequence:CCGGAGTCCTCCTCCTAGACCTTTACTCGAGTAAAGGTCTAGGAGGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030225.3-132s21c1
Sequence:CCGGACAACAGGAAGATGGTCATTACTCGAGTAATGACCATCTTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks