EMAIL THIS PAGE TO A FRIEND

DLX1

distal-less homeobox 1

152 Gene Product Result for
UniProtKB ID: P56177, D3DPD7, Q53ZU4, Q7Z724, Q8IYB2
Gene ID:
Human(1745) Summary: This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. The encoded protein is localized to the nucleus where it may function as a transcriptional regulator of signals from multiple TGF-{beta} superfamily members. The encoded protein may play a role in the control of craniofacial patterning and the differentiation and survival of inhibitory neurons in the forebrain. This gene is located in a tail-to-tail configuration with another member of the family on the long arm of chromosome 2. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(13390) distal-less homeobox 1
Rat(296500) distal-less homeobox 1
chicken(429283) distal-less homeobox 1
domestic cat(101091802) distal-less homeobox 1
cow(521806) distal-less homeobox 1
dog(607766) distal-less homeobox 1
naked mole-rat(101703884) distal-less homeobox 1
domestic guinea pig(100718727) distal-less homeobox 1
sheep(101113912) distal-less homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
D8195 Anti-DLX1 (231-245) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
D8070 Anti-DLX1 (96-109) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405718 Anti-DLX1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1412018 ANTI-DLX1 antibody produced in mouse clone 3C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412019 ANTI-DLX1 antibody produced in mouse clone 3F9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412020 ANTI-DLX1 antibody produced in mouse clone 1D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412589 ANTI-DLX1 antibody produced in mouse clone 4H7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412590 ANTI-DLX1 antibody produced in mouse clone 4B7, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2100595 Anti-DLX1 antibody produced in rabbit affinity isolated antibody bovine, canine, rat, human, mouse, guinea pig, horse, rabbit
western blot pricing
HPA045884 Anti-DLX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA035666 Anti-DLX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2103510 Anti-DLX1, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, rat, bovine, zebrafish, rabbit, canine, human, guinea pig, horse
western blot pricing
WH0001745M1 Monoclonal Anti-DLX1 antibody produced in mouse clone 2H3, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunofluorescence, western blot pricing
SAB1403738 Monoclonal Anti-DLX1 antibody produced in mouse clone 1B2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178120 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010053 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010053 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010053 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001038493 Rosetta Predictions human pricing
NM_178120 Rosetta Predictions human pricing
XM_001059233 Rosetta Predictions rat pricing
XM_230987 Rosetta Predictions rat pricing
NM_010053 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152733 predicted 814
2 SASI_Hs01_00152734 predicted 233
3 SASI_Hs01_00152735 predicted 237
4 SASI_Hs01_00152736 predicted 764
5 SASI_Hs01_00152737 predicted 267
6 SASI_Hs01_00152738 predicted 715
7 SASI_Hs02_00308393 predicted 816
8 SASI_Hs01_00152739 predicted 768
9 SASI_Hs01_00152740 predicted 235
10 SASI_Hs01_00152741 predicted 260
11 SASI_Hs01_00152742 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039935 predicted 1015
2 SASI_Hs01_00039936 predicted 234
3 SASI_Hs01_00039937 predicted 236
4 SASI_Hs01_00039938 predicted 967
5 SASI_Hs01_00039939 predicted 270
6 SASI_Hs01_00039940 predicted 911
7 SASI_Hs02_00369525 predicted 1020
8 SASI_Hs01_00039941 predicted 970
9 SASI_Hs01_00039942 predicted 234
10 SASI_Hs01_00039944 predicted 261
11 SASI_Hs01_00039943 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292554 predicted 1322
2 SASI_Rn02_00292555 predicted 943
3 SASI_Rn02_00292556 predicted 1331
4 SASI_Rn02_00292557 predicted 1699
5 SASI_Rn02_00292558 predicted 1691
6 SASI_Rn02_00292559 predicted 1434
7 SASI_Rn02_00292560 predicted 1288
8 SASI_Rn02_00292561 predicted 1049
9 SASI_Rn02_00292562 predicted 1682
10 SASI_Rn02_00292563 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386622 predicted 1321
2 SASI_Rn02_00386623 predicted 936
3 SASI_Rn02_00386624 predicted 1335
4 SASI_Rn02_00386625 predicted 1700
5 SASI_Rn02_00386626 predicted 1687
6 SASI_Rn02_00386627 predicted 1439
7 SASI_Rn02_00386628 predicted 1285
8 SASI_Rn02_00386629 predicted 1056
9 SASI_Rn02_00386630 predicted 1673
10 SASI_Rn02_00386631 predicted 1659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197013 predicted 984
2 SASI_Mm02_00317694 predicted 1647
3 SASI_Mm01_00197014 predicted 1522
4 SASI_Mm01_00197015 predicted 1308
5 SASI_Mm01_00197016 predicted 1296
6 SASI_Mm01_00197017 predicted 1261
7 SASI_Mm01_00197018 predicted 1295
8 SASI_Mm01_00197019 predicted 1550
9 SASI_Mm01_00197021 predicted 1287
10 SASI_Mm01_00197022 predicted 1650
11 SASI_Mm01_00197020 predicted 1311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178120
DLX1 MISSION shRNA Bacterial Glycerol Stock
distal-less homeobox 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178120.4-592s21c1
Sequence:CCGGAGGACGATTTATTCCAGTTTGCTCGAGCAAACTGGAATAAATCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178120.4-1220s21c1
Sequence:CCGGAGCCCAAGCAGCAAGATAAACCTCGAGGTTTATCTTGCTGCTTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178120.4-1362s21c1
Sequence:CCGGCTCTGTCTGTGCGCTGGTAAACTCGAGTTTACCAGCGCACAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178120.4-925s21c1
Sequence:CCGGTCAGCGCACCAAGAAGCTATGCTCGAGCATAGCTTCTTGGTGCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178120.2-1586s1c1
Sequence:CCGGGCACTGTTCAAACGCACTGTTCTCGAGAACAGTGCGTTTGAACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178120.2-698s1c1
Sequence:CCGGCAAGCGATCCAAGTTCAAGAACTCGAGTTCTTGAACTTGGATCGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178120.2-815s1c1
Sequence:CCGGCCCTAACTCTTCATCCGGGAACTCGAGTTCCCGGATGAAGAGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178120.2-278s1c1
Sequence:CCGGGCACTACTCCATGCACTGTTTCTCGAGAAACAGTGCATGGAGTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178120.2-556s1c1
Sequence:CCGGCCAGGACGATTTATTGCAGTTCTCGAGAACTGCAATAAATCGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178120
DLX1 MISSION shRNA shRNA Plasmid DNA
distal-less homeobox 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178120.4-592s21c1
Sequence:CCGGAGGACGATTTATTCCAGTTTGCTCGAGCAAACTGGAATAAATCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178120.4-1220s21c1
Sequence:CCGGAGCCCAAGCAGCAAGATAAACCTCGAGGTTTATCTTGCTGCTTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178120.4-1362s21c1
Sequence:CCGGCTCTGTCTGTGCGCTGGTAAACTCGAGTTTACCAGCGCACAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178120.4-925s21c1
Sequence:CCGGTCAGCGCACCAAGAAGCTATGCTCGAGCATAGCTTCTTGGTGCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178120.2-1586s1c1
Sequence:CCGGGCACTGTTCAAACGCACTGTTCTCGAGAACAGTGCGTTTGAACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178120.2-698s1c1
Sequence:CCGGCAAGCGATCCAAGTTCAAGAACTCGAGTTCTTGAACTTGGATCGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178120.2-815s1c1
Sequence:CCGGCCCTAACTCTTCATCCGGGAACTCGAGTTCCCGGATGAAGAGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178120.2-278s1c1
Sequence:CCGGGCACTACTCCATGCACTGTTTCTCGAGAAACAGTGCATGGAGTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178120.2-556s1c1
Sequence:CCGGCCAGGACGATTTATTGCAGTTCTCGAGAACTGCAATAAATCGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178120
DLX1 MISSION shRNA Lentiviral Transduction Particles
distal-less homeobox 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178120.4-592s21c1
Sequence:CCGGAGGACGATTTATTCCAGTTTGCTCGAGCAAACTGGAATAAATCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178120.4-1220s21c1
Sequence:CCGGAGCCCAAGCAGCAAGATAAACCTCGAGGTTTATCTTGCTGCTTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178120.4-1362s21c1
Sequence:CCGGCTCTGTCTGTGCGCTGGTAAACTCGAGTTTACCAGCGCACAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178120.4-925s21c1
Sequence:CCGGTCAGCGCACCAAGAAGCTATGCTCGAGCATAGCTTCTTGGTGCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178120.2-1586s1c1
Sequence:CCGGGCACTGTTCAAACGCACTGTTCTCGAGAACAGTGCGTTTGAACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178120.2-698s1c1
Sequence:CCGGCAAGCGATCCAAGTTCAAGAACTCGAGTTCTTGAACTTGGATCGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178120.2-815s1c1
Sequence:CCGGCCCTAACTCTTCATCCGGGAACTCGAGTTCCCGGATGAAGAGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178120.2-278s1c1
Sequence:CCGGGCACTACTCCATGCACTGTTTCTCGAGAAACAGTGCATGGAGTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178120.2-556s1c1
Sequence:CCGGCCAGGACGATTTATTGCAGTTCTCGAGAACTGCAATAAATCGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010053
VALIDATED
DLX1 MISSION shRNA Bacterial Glycerol Stock
distal-less homeobox 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010053.1-1252s21c1
Sequence:CCGGCCCAGCTATACATCATGGTATCTCGAGATACCATGATGTATAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010053.1-907s21c1
Sequence:CCGGCGCTTTAACGGCAAAGGGAAACTCGAGTTTCCCTTTGCCGTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010053.1-665s21c1
Sequence:CCGGACTACTCCATGCACTGTTTACCTCGAGGTAAACAGTGCATGGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010053.1-1052s21c1
Sequence:CCGGCACAGACGCAGGTCAAGATATCTCGAGATATCTTGACCTGCGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010053.1-799s21c1
Sequence:CCGGATCAGTTCCGTGCAGTCCTACCTCGAGGTAGGACTGCACGGAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010053.1-1252s1c1
Sequence:CCGGCCCAGCTATACATCATGGTATCTCGAGATACCATGATGTATAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010053.1-713s1c1
Sequence:CCGGGTGCCTACAGTTCGGCCTCATCTCGAGATGAGGCCGAACTGTAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010053.1-626s1c1
Sequence:CCGGCCAACCAGCAAATGTCTCCTTCTCGAGAAGGAGACATTTGCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010053.1-907s1c1
Sequence:CCGGCGCTTTAACGGCAAAGGGAAACTCGAGTTTCCCTTTGCCGTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010053.1-969s1c1
Sequence:CCGGGCAGGCTTTGAACCGGAGGTTCTCGAGAACCTCCGGTTCAAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010053
VALIDATED
DLX1 MISSION shRNA shRNA Plasmid DNA
distal-less homeobox 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010053.1-1252s21c1
Sequence:CCGGCCCAGCTATACATCATGGTATCTCGAGATACCATGATGTATAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010053.1-907s21c1
Sequence:CCGGCGCTTTAACGGCAAAGGGAAACTCGAGTTTCCCTTTGCCGTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010053.1-665s21c1
Sequence:CCGGACTACTCCATGCACTGTTTACCTCGAGGTAAACAGTGCATGGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010053.1-1052s21c1
Sequence:CCGGCACAGACGCAGGTCAAGATATCTCGAGATATCTTGACCTGCGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010053.1-799s21c1
Sequence:CCGGATCAGTTCCGTGCAGTCCTACCTCGAGGTAGGACTGCACGGAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010053.1-1252s1c1
Sequence:CCGGCCCAGCTATACATCATGGTATCTCGAGATACCATGATGTATAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010053.1-713s1c1
Sequence:CCGGGTGCCTACAGTTCGGCCTCATCTCGAGATGAGGCCGAACTGTAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010053.1-626s1c1
Sequence:CCGGCCAACCAGCAAATGTCTCCTTCTCGAGAAGGAGACATTTGCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010053.1-907s1c1
Sequence:CCGGCGCTTTAACGGCAAAGGGAAACTCGAGTTTCCCTTTGCCGTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010053.1-969s1c1
Sequence:CCGGGCAGGCTTTGAACCGGAGGTTCTCGAGAACCTCCGGTTCAAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010053
VALIDATED
DLX1 MISSION shRNA Lentiviral Transduction Particles
distal-less homeobox 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010053.1-1252s21c1
Sequence:CCGGCCCAGCTATACATCATGGTATCTCGAGATACCATGATGTATAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010053.1-907s21c1
Sequence:CCGGCGCTTTAACGGCAAAGGGAAACTCGAGTTTCCCTTTGCCGTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010053.1-665s21c1
Sequence:CCGGACTACTCCATGCACTGTTTACCTCGAGGTAAACAGTGCATGGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010053.1-1052s21c1
Sequence:CCGGCACAGACGCAGGTCAAGATATCTCGAGATATCTTGACCTGCGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010053.1-799s21c1
Sequence:CCGGATCAGTTCCGTGCAGTCCTACCTCGAGGTAGGACTGCACGGAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010053.1-1252s1c1
Sequence:CCGGCCCAGCTATACATCATGGTATCTCGAGATACCATGATGTATAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010053.1-713s1c1
Sequence:CCGGGTGCCTACAGTTCGGCCTCATCTCGAGATGAGGCCGAACTGTAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010053.1-626s1c1
Sequence:CCGGCCAACCAGCAAATGTCTCCTTCTCGAGAAGGAGACATTTGCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010053.1-907s1c1
Sequence:CCGGCGCTTTAACGGCAAAGGGAAACTCGAGTTTCCCTTTGCCGTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010053.1-969s1c1
Sequence:CCGGGCAGGCTTTGAACCGGAGGTTCTCGAGAACCTCCGGTTCAAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks