EMAIL THIS PAGE TO A FRIEND

DLX2

distal-less homeobox 2

62 Gene Product Result for
Synonyms: TES-1 TES1
UniProtKB ID: Q07687
Gene ID:
Human(1746) Summary: Many vertebrate homeo box-containing genes have been identified on the basis of their sequence similarity with Drosophila developmental genes. Members of the Dlx gene family contain a homeobox that is related to that of Distal-less (Dll), a gene expressed in the head and limbs of the developing fruit fly. The Distal-less (Dlx) family of genes comprises at least 6 different members, DLX1-DLX6. The DLX proteins are postulated to play a role in forebrain and craniofacial development. This gene is located in a tail-to-tail configuration with another member of the gene family on the long arm of chromosome 2. [provided by RefSeq, Jul 2008]
Mouse(13392) distal-less homeobox 2
Rat(296499) distal-less homeobox 2
sheep(101106667) distal-less homeobox 2
domestic guinea pig(100718165) distal-less homeobox 2
naked mole-rat(101704493) distal-less homeobox 2
domestic cat(101092203) distal-less homeobox 2
dog(607779) distal-less homeobox 2
cow(528490) distal-less homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31604 Anti-DLX2 (AB1) antibody produced in rabbit IgG fraction of antiserum canine, human, horse, bovine, mouse, guinea pig
immunohistochemistry, western blot pricing
AV32212 Anti-DLX2 (AB2) antibody produced in rabbit IgG fraction of antiserum canine, guinea pig, human, mouse, rat, bovine
immunohistochemistry, western blot pricing
HPA039071 Anti-DLX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA056965 Anti-DLX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0001746M1 Monoclonal Anti-DLX2 antibody produced in mouse clone 2H2, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunohistochemistry, western blot pricing
SAB1408949 Monoclonal Anti-DLX2 antibody produced in mouse clone 3H3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408950 Monoclonal Anti-DLX2 antibody produced in mouse clone 3G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408951 Monoclonal Anti-DLX2 antibody produced in mouse clone 1E9, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, western blot pricing
SAB1403739 Monoclonal Anti-DLX2, (N-terminal) antibody produced in mouse clone 4B9, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004405 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010054 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010054 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010054 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004405 Rosetta Predictions human pricing
XM_001060785 Rosetta Predictions rat pricing
XM_230986 Rosetta Predictions rat pricing
NM_010054 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066617 predicted 706
2 SASI_Hs02_00337536 predicted 1201
3 SASI_Hs01_00066618 predicted 1234
4 SASI_Hs01_00066619 predicted 698
5 SASI_Hs01_00066620 predicted 1214
6 SASI_Hs01_00066621 predicted 670
7 SASI_Hs01_00066622 predicted 1229
8 SASI_Hs01_00066623 predicted 1561
9 SASI_Hs01_00066624 predicted 684
10 SASI_Hs01_00066625 predicted 933
11 SASI_Hs01_00066626 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297701 predicted 760
2 SASI_Rn02_00297702 predicted 776
3 SASI_Rn02_00297703 predicted 777
4 SASI_Rn02_00297704 predicted 859
5 SASI_Rn02_00297705 predicted 818
6 SASI_Rn02_00297706 predicted 803
7 SASI_Rn02_00297707 predicted 767
8 SASI_Rn02_00297708 predicted 739
9 SASI_Rn02_00297709 predicted 1596
10 SASI_Rn02_00297710 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386612 predicted 1770
2 SASI_Rn02_00386613 predicted 761
3 SASI_Rn02_00386614 predicted 610
4 SASI_Rn02_00386615 predicted 615
5 SASI_Rn02_00386616 predicted 679
6 SASI_Rn02_00386617 predicted 645
7 SASI_Rn02_00386618 predicted 1352
8 SASI_Rn02_00386619 predicted 866
9 SASI_Rn02_00386620 predicted 1457
10 SASI_Rn02_00386621 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049442 predicted 1363
2 SASI_Mm02_00317695 predicted 976
3 SASI_Mm01_00049443 predicted 871
4 SASI_Mm01_00049445 predicted 806
5 SASI_Mm01_00049446 predicted 1235
6 SASI_Mm01_00049447 predicted 1554
7 SASI_Mm01_00049448 predicted 825
8 SASI_Mm01_00049449 predicted 835
9 SASI_Mm01_00049450 predicted 861
10 SASI_Mm01_00049451 predicted 820
11 SASI_Mm01_00049444 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004405
VALIDATED
DLX2 MISSION shRNA Bacterial Glycerol Stock
distal-less homeobox 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_004405.2-1941s1c1
Sequence:CCGGGCTACTGATTTGGATTTGTTTCTCGAGAAACAAATCCAAATCAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_004405.2-433s1c1
Sequence:CCGGGTGAACGGGAAGCCAAAGAAACTCGAGTTTCTTTGGCTTCCCGTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_004405.2-30s1c1
Sequence:CCGGTGATATGCACTCGACCCAGATCTCGAGATCTGGGTCGAGTGCATATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004405.2-417s1c1
Sequence:CCGGGCCTGAAATTCGGATAGTGAACTCGAGTTCACTATCCGAATTTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004405.3-678s21c1
Sequence:CCGGCGCACCATCTACTCCAGTTTCCTCGAGGAAACTGGAGTAGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004405.3-1224s21c1
Sequence:CCGGTGAGAGCAGAGACCACTTATCCTCGAGGATAAGTGGTCTCTGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004405.3-619s21c1
Sequence:CCGGAGGACCTTGAGCCTGAAATTCCTCGAGGAATTTCAGGCTCAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004405.3-558s21c1
Sequence:CCGGTACACCTCCTACGCTCCCTATCTCGAGATAGGGAGCGTAGGAGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004405
VALIDATED
DLX2 MISSION shRNA shRNA Plasmid DNA
distal-less homeobox 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_004405.2-1941s1c1
Sequence:CCGGGCTACTGATTTGGATTTGTTTCTCGAGAAACAAATCCAAATCAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_004405.2-433s1c1
Sequence:CCGGGTGAACGGGAAGCCAAAGAAACTCGAGTTTCTTTGGCTTCCCGTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_004405.2-30s1c1
Sequence:CCGGTGATATGCACTCGACCCAGATCTCGAGATCTGGGTCGAGTGCATATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004405.2-417s1c1
Sequence:CCGGGCCTGAAATTCGGATAGTGAACTCGAGTTCACTATCCGAATTTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004405.3-678s21c1
Sequence:CCGGCGCACCATCTACTCCAGTTTCCTCGAGGAAACTGGAGTAGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004405.3-1224s21c1
Sequence:CCGGTGAGAGCAGAGACCACTTATCCTCGAGGATAAGTGGTCTCTGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004405.3-619s21c1
Sequence:CCGGAGGACCTTGAGCCTGAAATTCCTCGAGGAATTTCAGGCTCAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004405.3-558s21c1
Sequence:CCGGTACACCTCCTACGCTCCCTATCTCGAGATAGGGAGCGTAGGAGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004405
VALIDATED
DLX2 MISSION shRNA Lentiviral Transduction Particles
distal-less homeobox 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_004405.2-1941s1c1
Sequence:CCGGGCTACTGATTTGGATTTGTTTCTCGAGAAACAAATCCAAATCAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_004405.2-433s1c1
Sequence:CCGGGTGAACGGGAAGCCAAAGAAACTCGAGTTTCTTTGGCTTCCCGTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_004405.2-30s1c1
Sequence:CCGGTGATATGCACTCGACCCAGATCTCGAGATCTGGGTCGAGTGCATATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004405.2-417s1c1
Sequence:CCGGGCCTGAAATTCGGATAGTGAACTCGAGTTCACTATCCGAATTTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004405.3-678s21c1
Sequence:CCGGCGCACCATCTACTCCAGTTTCCTCGAGGAAACTGGAGTAGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004405.3-1224s21c1
Sequence:CCGGTGAGAGCAGAGACCACTTATCCTCGAGGATAAGTGGTCTCTGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004405.3-619s21c1
Sequence:CCGGAGGACCTTGAGCCTGAAATTCCTCGAGGAATTTCAGGCTCAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004405.3-558s21c1
Sequence:CCGGTACACCTCCTACGCTCCCTATCTCGAGATAGGGAGCGTAGGAGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010054
VALIDATED
DLX2 MISSION shRNA Bacterial Glycerol Stock
distal-less homeobox 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010054.1-775s1c1
Sequence:CCGGGCCTGAAATCCGAATAGTGAACTCGAGTTCACTATTCGGATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010054.1-967s1c1
Sequence:CCGGCCGATCCAAGTTCAAGAAGATCTCGAGATCTTCTTGAACTTGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010054.1-1174s1c1
Sequence:CCGGCTCGGCCTTTCTGGGAAACTACTCGAGTAGTTTCCCAGAAAGGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010054.1-855s1c1
Sequence:CCGGCCCTTCAACGACGCTTCCAGACTCGAGTCTGGAAGCGTCGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010054.1-645s1c1
Sequence:CCGGGCCTCAACAATGTCTCCTACTCTCGAGAGTAGGAGACATTGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010054.2-880s21c1
Sequence:CCGGGCTTCCAGAAGACCCAGTATCCTCGAGGATACTGGGTCTTCTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010054.2-743s21c1
Sequence:CCGGCAGTTCGTCTCCGGTCAACAACTCGAGTTGTTGACCGGAGACGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010054.2-1790s21c1
Sequence:CCGGTCCAGTCCGCTTCGGTTATTGCTCGAGCAATAACCGAAGCGGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010054.2-783s21c1
Sequence:CCGGCTTGAGCCTGAAATCCGAATACTCGAGTATTCGGATTTCAGGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010054.2-554s21c1
Sequence:CCGGTACGGACAGCAGCTACTACACCTCGAGGTGTAGTAGCTGCTGTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010054
VALIDATED
DLX2 MISSION shRNA shRNA Plasmid DNA
distal-less homeobox 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010054.1-775s1c1
Sequence:CCGGGCCTGAAATCCGAATAGTGAACTCGAGTTCACTATTCGGATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010054.1-967s1c1
Sequence:CCGGCCGATCCAAGTTCAAGAAGATCTCGAGATCTTCTTGAACTTGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010054.1-1174s1c1
Sequence:CCGGCTCGGCCTTTCTGGGAAACTACTCGAGTAGTTTCCCAGAAAGGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010054.1-855s1c1
Sequence:CCGGCCCTTCAACGACGCTTCCAGACTCGAGTCTGGAAGCGTCGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010054.1-645s1c1
Sequence:CCGGGCCTCAACAATGTCTCCTACTCTCGAGAGTAGGAGACATTGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010054.2-880s21c1
Sequence:CCGGGCTTCCAGAAGACCCAGTATCCTCGAGGATACTGGGTCTTCTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010054.2-743s21c1
Sequence:CCGGCAGTTCGTCTCCGGTCAACAACTCGAGTTGTTGACCGGAGACGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010054.2-1790s21c1
Sequence:CCGGTCCAGTCCGCTTCGGTTATTGCTCGAGCAATAACCGAAGCGGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010054.2-783s21c1
Sequence:CCGGCTTGAGCCTGAAATCCGAATACTCGAGTATTCGGATTTCAGGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010054.2-554s21c1
Sequence:CCGGTACGGACAGCAGCTACTACACCTCGAGGTGTAGTAGCTGCTGTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010054
VALIDATED
DLX2 MISSION shRNA Lentiviral Transduction Particles
distal-less homeobox 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010054.1-775s1c1
Sequence:CCGGGCCTGAAATCCGAATAGTGAACTCGAGTTCACTATTCGGATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010054.1-967s1c1
Sequence:CCGGCCGATCCAAGTTCAAGAAGATCTCGAGATCTTCTTGAACTTGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010054.1-1174s1c1
Sequence:CCGGCTCGGCCTTTCTGGGAAACTACTCGAGTAGTTTCCCAGAAAGGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010054.1-855s1c1
Sequence:CCGGCCCTTCAACGACGCTTCCAGACTCGAGTCTGGAAGCGTCGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010054.1-645s1c1
Sequence:CCGGGCCTCAACAATGTCTCCTACTCTCGAGAGTAGGAGACATTGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010054.2-880s21c1
Sequence:CCGGGCTTCCAGAAGACCCAGTATCCTCGAGGATACTGGGTCTTCTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010054.2-743s21c1
Sequence:CCGGCAGTTCGTCTCCGGTCAACAACTCGAGTTGTTGACCGGAGACGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010054.2-1790s21c1
Sequence:CCGGTCCAGTCCGCTTCGGTTATTGCTCGAGCAATAACCGAAGCGGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010054.2-783s21c1
Sequence:CCGGCTTGAGCCTGAAATCCGAATACTCGAGTATTCGGATTTCAGGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010054.2-554s21c1
Sequence:CCGGTACGGACAGCAGCTACTACACCTCGAGGTGTAGTAGCTGCTGTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks