EMAIL THIS PAGE TO A FRIEND

DLX3

distal-less homeobox 3

177 Gene Product Result for
Synonyms: AI4 TDO
UniProtKB ID: O60479, B3KQL6
Gene ID:
Human(1747) Summary: Many vertebrate homeo box-containing genes have been identified on the basis of their sequence similarity with Drosophila developmental genes. Members of the Dlx gene family contain a homeobox that is related to that of Distal-less (Dll), a gene expressed in the head and limbs of the developing fruit fly. The Distal-less (Dlx) family of genes comprises at least 6 different members, DLX1-DLX6. Trichodentoosseous syndrome (TDO), an autosomal dominant condition, has been correlated with DLX3 gene mutation. This gene is located in a tail-to-tail configuration with another member of the gene family on the long arm of chromosome 17. Mutations in this gene have been associated with the autosomal dominant conditions trichodentoosseous syndrome and amelogenesis imperfecta with taurodontism. [provided by RefSeq, Jul 2008]
Mouse(13393) distal-less homeobox 3
Rat(287638) distal-less homeobox 3
chicken(395590) distal-less homeobox 3
domestic cat(101100263) distal-less homeobox 3
cow(784366) distal-less homeobox 3
dog(491073) distal-less homeobox 3
naked mole-rat(101699052) distal-less homeobox 3
domestic guinea pig(100735447) distal-less homeobox 3
sheep(101109372) distal-less homeobox 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
D5445 Anti-DLX3 (241-255) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
D5320 Anti-DLX3 (46-60) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV32213 Anti-DLX3 (AB1) antibody produced in rabbit affinity isolated antibody human, rabbit, sheep, mouse, guinea pig, bovine, horse, rat, canine
immunohistochemistry, western blot pricing
AV38584 Anti-DLX3 (AB2) antibody produced in rabbit IgG fraction of antiserum human, rat, guinea pig, rabbit, sheep, mouse, bovine, horse, canine
western blot pricing
SAB1412375 ANTI-DLX3 antibody produced in mouse clone 3C3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2100596 Anti-DLX3 antibody produced in rabbit affinity isolated antibody mouse, rabbit, rat, horse, guinea pig, canine, human, bovine, sheep
western blot pricing
HPA031164 Anti-DLX3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4500658 Anti-DLX3 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
WH0001747M1 Monoclonal Anti-DLX3 antibody produced in mouse clone 4F8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403740 Monoclonal Anti-DLX3 antibody produced in mouse clone 3B8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005220 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005220 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005220 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010055 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010055 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010055 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005220 Rosetta Predictions human pricing
NM_001105832 Rosetta Predictions rat pricing
NM_010055 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239922 predicted 758
2 SASI_Hs01_00239923 predicted 828
3 SASI_Hs02_00339206 predicted 571
4 SASI_Hs01_00239924 predicted 1465
5 SASI_Hs01_00239925 predicted 1224
6 SASI_Hs01_00239927 predicted 1574
7 SASI_Hs01_00239928 predicted 1520
8 SASI_Hs01_00239930 predicted 453
9 SASI_Hs02_00339207 predicted 544
10 SASI_Hs01_00239931 predicted 246
11 SASI_Hs01_00239926 predicted 1377
12 SASI_Hs01_00239929 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212966 predicted 581
2 SASI_Rn02_00212967 predicted 284
3 SASI_Rn02_00212968 predicted 1314
4 SASI_Rn02_00212969 predicted 832
5 SASI_Rn02_00212970 predicted 1532
6 SASI_Rn02_00212971 predicted 1342
7 SASI_Rn02_00212972 predicted 411
8 SASI_Rn02_00212973 predicted 1387
9 SASI_Rn02_00212974 predicted 1539
10 SASI_Rn02_00212975 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093062 predicted 302
2 SASI_Mm01_00093063 predicted 591
3 SASI_Mm01_00093064 predicted 804
4 SASI_Mm01_00093065 predicted 1204
5 SASI_Mm02_00317696 predicted 1288
6 SASI_Mm01_00093066 predicted 1055
7 SASI_Mm01_00093068 predicted 435
8 SASI_Mm01_00093069 predicted 594
9 SASI_Mm01_00093070 predicted 1200
10 SASI_Mm02_00317697 predicted 226
11 SASI_Mm01_00093061 predicted 808
12 SASI_Mm01_00093067 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005220
DLX3 MISSION shRNA Bacterial Glycerol Stock
distal-less homeobox 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005220.2-981s21c1
Sequence:CCGGATCACGCACAGAACCTGAGTGCTCGAGCACTCAGGTTCTGTGCGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005220.2-1396s21c1
Sequence:CCGGATCATCTTCCAGCTTCTTAAACTCGAGTTTAAGAAGCTGGAAGATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005220.2-1234s21c1
Sequence:CCGGAGCGCTTCCAGATGACATTTGCTCGAGCAAATGTCATCTGGAAGCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005220.2-622s1c1
Sequence:CCGGGCGTACGATCTACTCCAGCTACTCGAGTAGCTGGAGTAGATCGTACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005220.2-322s1c1
Sequence:CCGGGCCCGAGTCTTCTGTCACTGACTCGAGTCAGTGACAGAAGACTCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005220.2-1954s1c1
Sequence:CCGGCCTTCTCTACTCCTCCAGTAACTCGAGTTACTGGAGGAGTAGAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005220.2-816s1c1
Sequence:CCGGACAGTCCCAATAACAGTGATTCTCGAGAATCACTGTTATTGGGACTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005220.2-428s1c1
Sequence:CCGGCAATTCAATCTCAATGGGCTTCTCGAGAAGCCCATTGAGATTGAATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005220
DLX3 MISSION shRNA shRNA Plasmid DNA
distal-less homeobox 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005220.2-981s21c1
Sequence:CCGGATCACGCACAGAACCTGAGTGCTCGAGCACTCAGGTTCTGTGCGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005220.2-1396s21c1
Sequence:CCGGATCATCTTCCAGCTTCTTAAACTCGAGTTTAAGAAGCTGGAAGATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005220.2-1234s21c1
Sequence:CCGGAGCGCTTCCAGATGACATTTGCTCGAGCAAATGTCATCTGGAAGCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005220.2-622s1c1
Sequence:CCGGGCGTACGATCTACTCCAGCTACTCGAGTAGCTGGAGTAGATCGTACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005220.2-322s1c1
Sequence:CCGGGCCCGAGTCTTCTGTCACTGACTCGAGTCAGTGACAGAAGACTCGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005220.2-1954s1c1
Sequence:CCGGCCTTCTCTACTCCTCCAGTAACTCGAGTTACTGGAGGAGTAGAGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005220.2-816s1c1
Sequence:CCGGACAGTCCCAATAACAGTGATTCTCGAGAATCACTGTTATTGGGACTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005220.2-428s1c1
Sequence:CCGGCAATTCAATCTCAATGGGCTTCTCGAGAAGCCCATTGAGATTGAATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005220
DLX3 MISSION shRNA Lentiviral Transduction Particles
distal-less homeobox 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005220.2-981s21c1
Sequence:CCGGATCACGCACAGAACCTGAGTGCTCGAGCACTCAGGTTCTGTGCGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005220.2-1396s21c1
Sequence:CCGGATCATCTTCCAGCTTCTTAAACTCGAGTTTAAGAAGCTGGAAGATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005220.2-1234s21c1
Sequence:CCGGAGCGCTTCCAGATGACATTTGCTCGAGCAAATGTCATCTGGAAGCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005220.2-622s1c1
Sequence:CCGGGCGTACGATCTACTCCAGCTACTCGAGTAGCTGGAGTAGATCGTACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005220.2-322s1c1
Sequence:CCGGGCCCGAGTCTTCTGTCACTGACTCGAGTCAGTGACAGAAGACTCGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005220.2-1954s1c1
Sequence:CCGGCCTTCTCTACTCCTCCAGTAACTCGAGTTACTGGAGGAGTAGAGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005220.2-816s1c1
Sequence:CCGGACAGTCCCAATAACAGTGATTCTCGAGAATCACTGTTATTGGGACTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005220.2-428s1c1
Sequence:CCGGCAATTCAATCTCAATGGGCTTCTCGAGAAGCCCATTGAGATTGAATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010055
DLX3 MISSION shRNA Bacterial Glycerol Stock
distal-less homeobox 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010055.2-1209s21c1
Sequence:CCGGGACCCAACAACCTCCAGATAACTCGAGTTATCTGGAGGTTGTTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010055.2-336s21c1
Sequence:CCGGGCTCCTCAGCATGACTACTACCTCGAGGTAGTAGTCATGCTGAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010055.2-1506s21c1
Sequence:CCGGACATTCTTGAGCCACTCTTTACTCGAGTAAAGAGTGGCTCAAGAATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010055.2-1136s21c1
Sequence:CCGGAGCGACACTCAGGAATCATTGCTCGAGCAATGATTCCTGAGTGTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-600s1c1
Sequence:CCGGCGAACGATCTACTCCAGCTATCTCGAGATAGCTGGAGTAGATCGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-642s1c1
Sequence:CCGGCGTTTCCAGAAAGCCCAGTATCTCGAGATACTGGGCTTTCTGGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-398s1c1
Sequence:CCGGCCACCACCAGTTCAATCTCAACTCGAGTTGAGATTGAACTGGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-704s1c1
Sequence:CCGGCCTCACACAAACACAGGTGAACTCGAGTTCACCTGTGTTTGTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-299s1c1
Sequence:CCGGGCCCGAATCTACAGTCACTGACTCGAGTCAGTGACTGTAGATTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010055
DLX3 MISSION shRNA shRNA Plasmid DNA
distal-less homeobox 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010055.2-1209s21c1
Sequence:CCGGGACCCAACAACCTCCAGATAACTCGAGTTATCTGGAGGTTGTTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010055.2-336s21c1
Sequence:CCGGGCTCCTCAGCATGACTACTACCTCGAGGTAGTAGTCATGCTGAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010055.2-1506s21c1
Sequence:CCGGACATTCTTGAGCCACTCTTTACTCGAGTAAAGAGTGGCTCAAGAATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010055.2-1136s21c1
Sequence:CCGGAGCGACACTCAGGAATCATTGCTCGAGCAATGATTCCTGAGTGTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-600s1c1
Sequence:CCGGCGAACGATCTACTCCAGCTATCTCGAGATAGCTGGAGTAGATCGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-642s1c1
Sequence:CCGGCGTTTCCAGAAAGCCCAGTATCTCGAGATACTGGGCTTTCTGGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-398s1c1
Sequence:CCGGCCACCACCAGTTCAATCTCAACTCGAGTTGAGATTGAACTGGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-704s1c1
Sequence:CCGGCCTCACACAAACACAGGTGAACTCGAGTTCACCTGTGTTTGTGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-299s1c1
Sequence:CCGGGCCCGAATCTACAGTCACTGACTCGAGTCAGTGACTGTAGATTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010055
DLX3 MISSION shRNA Lentiviral Transduction Particles
distal-less homeobox 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010055.2-1209s21c1
Sequence:CCGGGACCCAACAACCTCCAGATAACTCGAGTTATCTGGAGGTTGTTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010055.2-336s21c1
Sequence:CCGGGCTCCTCAGCATGACTACTACCTCGAGGTAGTAGTCATGCTGAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010055.2-1506s21c1
Sequence:CCGGACATTCTTGAGCCACTCTTTACTCGAGTAAAGAGTGGCTCAAGAATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010055.2-1136s21c1
Sequence:CCGGAGCGACACTCAGGAATCATTGCTCGAGCAATGATTCCTGAGTGTCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-600s1c1
Sequence:CCGGCGAACGATCTACTCCAGCTATCTCGAGATAGCTGGAGTAGATCGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-642s1c1
Sequence:CCGGCGTTTCCAGAAAGCCCAGTATCTCGAGATACTGGGCTTTCTGGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-398s1c1
Sequence:CCGGCCACCACCAGTTCAATCTCAACTCGAGTTGAGATTGAACTGGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-704s1c1
Sequence:CCGGCCTCACACAAACACAGGTGAACTCGAGTTCACCTGTGTTTGTGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010055.2-299s1c1
Sequence:CCGGGCCCGAATCTACAGTCACTGACTCGAGTCAGTGACTGTAGATTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)