EMAIL THIS PAGE TO A FRIEND

DLX4

distal-less homeobox 4

91 Gene Product Result for
Synonyms: BP1 DLX7 DLX8 DLX9
Gene ID:
Human(1748) Summary: Many vertebrate homeo box-containing genes have been identified on the basis of their sequence similarity with Drosophila developmental genes. Members of the Dlx gene family contain a homeobox that is related to that of Distal-less (Dll), a gene expressed in the head and limbs of the developing fruit fly. The Distal-less (Dlx) family of genes comprises at least 6 different members, DLX1-DLX6. The DLX proteins are postulated to play a role in forebrain and craniofacial development. Three transcript variants have been described for this gene, however, the full length nature of one variant has not been described. Studies of the two splice variants revealed that one encoded isoform functions as a repressor of the beta-globin gene while the other isoform lacks that function. [provided by RefSeq, Jul 2008]
Mouse(13394) distal-less homeobox 4
Rat(303469) distal-less homeobox 4
domestic cat(101100522) distal-less homeobox 4
dog(609214) distal-less homeobox 4
cow(516030) distal-less homeobox 4
sheep(101109628) distal-less homeobox 4
naked mole-rat(101698685) distal-less homeobox 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
D6070 Anti-DLX4 (146-160) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2100597 Anti-DLX4 (ab1) antibody produced in rabbit affinity isolated antibody bovine, mouse, horse, rabbit, human, rat, guinea pig
western blot pricing
SAB2100598 Anti-DLX4 (ab2) antibody produced in rabbit affinity isolated antibody bovine, human
western blot pricing
SAB2100599 Anti-DLX4 (ab3) antibody produced in rabbit affinity isolated antibody rabbit, mouse, rat, guinea pig, bovine, human
western blot pricing
SAB2100600 Anti-DLX4 (ab4) antibody produced in rabbit affinity isolated antibody human
western blot pricing
AV36839 Anti-DLX4 antibody produced in rabbit IgG fraction of antiserum human, mouse, rat
western blot pricing
SAB2103440 Anti-DLX4 antibody produced in rabbit affinity isolated antibody mouse, rabbit, rat, guinea pig, bovine, human
western blot pricing
SAB2105247 Anti-DLX4 antibody produced in rabbit affinity isolated antibody guinea pig, horse, mouse, rabbit
western blot pricing
HPA059933 Anti-DLX4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4500659 Anti-DLX4 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
WH0001748M1 Monoclonal Anti-DLX4 antibody produced in mouse clone 1F11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001934 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001934 Rosetta Predictions human pricing
NM_138281 Rosetta Predictions human pricing
NM_001107040 Rosetta Predictions rat pricing
NM_007867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113487 predicted 919
2 SASI_Hs01_00113488 predicted 863
3 SASI_Hs01_00113489 predicted 886
4 SASI_Hs01_00113490 predicted 700
5 SASI_Hs01_00113491 predicted 686
6 SASI_Hs01_00113492 predicted 935
7 SASI_Hs01_00113493 predicted 530
8 SASI_Hs01_00113495 predicted 718
9 SASI_Hs01_00113496 predicted 736
10 SASI_Hs02_00332835 predicted 520
11 SASI_Hs01_00113494 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129666 predicted 1166
2 SASI_Hs01_00129667 predicted 1118
3 SASI_Hs01_00129668 predicted 1142
4 SASI_Hs01_00129669 predicted 957
5 SASI_Hs01_00129670 predicted 937
6 SASI_Hs01_00129671 predicted 1188
7 SASI_Hs01_00129672 predicted 785
8 SASI_Hs01_00129674 predicted 976
9 SASI_Hs01_00129675 predicted 991
10 SASI_Hs02_00363356 predicted 779
11 SASI_Hs01_00129673 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107040 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224896 predicted 257
2 SASI_Rn02_00224897 predicted 461
3 SASI_Rn02_00224898 predicted 963
4 SASI_Rn02_00224899 predicted 628
5 SASI_Rn02_00224900 predicted 346
6 SASI_Rn02_00224901 predicted 794
7 SASI_Rn02_00224902 predicted 241
8 SASI_Rn02_00224903 predicted 426
9 SASI_Rn02_00224904 predicted 636
10 SASI_Rn02_00224905 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026365 predicted 1187
2 SASI_Mm01_00026366 predicted 443
3 SASI_Mm01_00026367 predicted 396
4 SASI_Mm01_00026369 predicted 971
5 SASI_Mm01_00026370 predicted 1168
6 SASI_Mm01_00026371 predicted 1118
7 SASI_Mm01_00026372 predicted 1392
8 SASI_Mm02_00312653 predicted 955
9 SASI_Mm01_00026373 predicted 1520
10 SASI_Mm01_00026374 predicted 1534
11 SASI_Mm01_00026368 predicted 1255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001934
DLX4 MISSION shRNA Bacterial Glycerol Stock
distal-less homeobox 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001934.2-915s1c1
Sequence:CCGGCCCTAACCCTAACAGCTAAATCTCGAGATTTAGCTGTTAGGGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001934.2-540s1c1
Sequence:CCGGCAAGTATAAGAAGCTCCTGAACTCGAGTTCAGGAGCTTCTTATACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001934.2-687s1c1
Sequence:CCGGCAACAGCTTTGGAGCCTGGTACTCGAGTACCAGGCTCCAAAGCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001934.2-417s1c1
Sequence:CCGGGCAGCACCTAAACCAGCGTTTCTCGAGAAACGCTGGTTTAGGTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001934.2-378s1c1
Sequence:CCGGGCTCCGCAAGCCGAGGACCATCTCGAGATGGTCCTCGGCTTGCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001934.2-1163s21c1
Sequence:CCGGAGCAAGAAACATTGAGTATTTCTCGAGAAATACTCAATGTTTCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001934.2-736s21c1
Sequence:CCGGTCGCCTCAGATGATGTGAATCCTCGAGGATTCACATCATCTGAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001934.2-1202s21c1
Sequence:CCGGTTGGCCTTGCACAACCCATTTCTCGAGAAATGGGTTGTGCAAGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001934
DLX4 MISSION shRNA shRNA Plasmid DNA
distal-less homeobox 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001934.2-915s1c1
Sequence:CCGGCCCTAACCCTAACAGCTAAATCTCGAGATTTAGCTGTTAGGGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001934.2-540s1c1
Sequence:CCGGCAAGTATAAGAAGCTCCTGAACTCGAGTTCAGGAGCTTCTTATACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001934.2-687s1c1
Sequence:CCGGCAACAGCTTTGGAGCCTGGTACTCGAGTACCAGGCTCCAAAGCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001934.2-417s1c1
Sequence:CCGGGCAGCACCTAAACCAGCGTTTCTCGAGAAACGCTGGTTTAGGTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001934.2-378s1c1
Sequence:CCGGGCTCCGCAAGCCGAGGACCATCTCGAGATGGTCCTCGGCTTGCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001934.2-1163s21c1
Sequence:CCGGAGCAAGAAACATTGAGTATTTCTCGAGAAATACTCAATGTTTCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001934.2-736s21c1
Sequence:CCGGTCGCCTCAGATGATGTGAATCCTCGAGGATTCACATCATCTGAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001934.2-1202s21c1
Sequence:CCGGTTGGCCTTGCACAACCCATTTCTCGAGAAATGGGTTGTGCAAGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001934
DLX4 MISSION shRNA Lentiviral Transduction Particles
distal-less homeobox 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001934.2-915s1c1
Sequence:CCGGCCCTAACCCTAACAGCTAAATCTCGAGATTTAGCTGTTAGGGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001934.2-540s1c1
Sequence:CCGGCAAGTATAAGAAGCTCCTGAACTCGAGTTCAGGAGCTTCTTATACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001934.2-687s1c1
Sequence:CCGGCAACAGCTTTGGAGCCTGGTACTCGAGTACCAGGCTCCAAAGCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001934.2-417s1c1
Sequence:CCGGGCAGCACCTAAACCAGCGTTTCTCGAGAAACGCTGGTTTAGGTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001934.2-378s1c1
Sequence:CCGGGCTCCGCAAGCCGAGGACCATCTCGAGATGGTCCTCGGCTTGCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001934.2-1163s21c1
Sequence:CCGGAGCAAGAAACATTGAGTATTTCTCGAGAAATACTCAATGTTTCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001934.2-736s21c1
Sequence:CCGGTCGCCTCAGATGATGTGAATCCTCGAGGATTCACATCATCTGAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001934.2-1202s21c1
Sequence:CCGGTTGGCCTTGCACAACCCATTTCTCGAGAAATGGGTTGTGCAAGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007867
VALIDATED
DLX4 MISSION shRNA Bacterial Glycerol Stock
distal-less homeobox 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007867.1-462s1c1
Sequence:CCGGACTCACCCAAACCCAGGTAAACTCGAGTTTACCTGGGTTTGGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007867.1-645s1c1
Sequence:CCGGTGGCTATGACAACAGCCACTTCTCGAGAAGTGGCTGTTGTCATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007867.1-71s1c1
Sequence:CCGGCCCTGTCGGTAGTGGCTGCTTCTCGAGAAGCAGCCACTACCGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007867.1-498s1c1
Sequence:CCGGCAAACGCTCCAAATATAAGAACTCGAGTTCTTATATTTGGAGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007867.1-279s1c1
Sequence:CCGGCGAAGCAGAATCAGAGAAGCTCTCGAGAGCTTCTCTGATTCTGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-671s21c1
Sequence:CCGGCAAGCCCAGAACCATCTACTCCTCGAGGAGTAGATGGTTCTGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-719s21c1
Sequence:CCGGGCGTTTCCAGCACACCCAATACTCGAGTATTGGGTGTGCTGGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-1524s21c1
Sequence:CCGGCTTGTGCTTCTCCGCTTTAAACTCGAGTTTAAAGCGGAGAAGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-353s21c1
Sequence:CCGGTGGTGCCTCCAACGTTGTCTTCTCGAGAAGACAACGTTGGAGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-435s21c1
Sequence:CCGGACCGCAGCTTCTCCCGATTTGCTCGAGCAAATCGGGAGAAGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007867
VALIDATED
DLX4 MISSION shRNA shRNA Plasmid DNA
distal-less homeobox 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007867.1-462s1c1
Sequence:CCGGACTCACCCAAACCCAGGTAAACTCGAGTTTACCTGGGTTTGGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007867.1-645s1c1
Sequence:CCGGTGGCTATGACAACAGCCACTTCTCGAGAAGTGGCTGTTGTCATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007867.1-71s1c1
Sequence:CCGGCCCTGTCGGTAGTGGCTGCTTCTCGAGAAGCAGCCACTACCGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007867.1-498s1c1
Sequence:CCGGCAAACGCTCCAAATATAAGAACTCGAGTTCTTATATTTGGAGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007867.1-279s1c1
Sequence:CCGGCGAAGCAGAATCAGAGAAGCTCTCGAGAGCTTCTCTGATTCTGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-671s21c1
Sequence:CCGGCAAGCCCAGAACCATCTACTCCTCGAGGAGTAGATGGTTCTGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-719s21c1
Sequence:CCGGGCGTTTCCAGCACACCCAATACTCGAGTATTGGGTGTGCTGGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-1524s21c1
Sequence:CCGGCTTGTGCTTCTCCGCTTTAAACTCGAGTTTAAAGCGGAGAAGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-353s21c1
Sequence:CCGGTGGTGCCTCCAACGTTGTCTTCTCGAGAAGACAACGTTGGAGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-435s21c1
Sequence:CCGGACCGCAGCTTCTCCCGATTTGCTCGAGCAAATCGGGAGAAGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007867
VALIDATED
DLX4 MISSION shRNA Lentiviral Transduction Particles
distal-less homeobox 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007867.1-462s1c1
Sequence:CCGGACTCACCCAAACCCAGGTAAACTCGAGTTTACCTGGGTTTGGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007867.1-645s1c1
Sequence:CCGGTGGCTATGACAACAGCCACTTCTCGAGAAGTGGCTGTTGTCATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007867.1-71s1c1
Sequence:CCGGCCCTGTCGGTAGTGGCTGCTTCTCGAGAAGCAGCCACTACCGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007867.1-498s1c1
Sequence:CCGGCAAACGCTCCAAATATAAGAACTCGAGTTCTTATATTTGGAGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007867.1-279s1c1
Sequence:CCGGCGAAGCAGAATCAGAGAAGCTCTCGAGAGCTTCTCTGATTCTGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-671s21c1
Sequence:CCGGCAAGCCCAGAACCATCTACTCCTCGAGGAGTAGATGGTTCTGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-719s21c1
Sequence:CCGGGCGTTTCCAGCACACCCAATACTCGAGTATTGGGTGTGCTGGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-1524s21c1
Sequence:CCGGCTTGTGCTTCTCCGCTTTAAACTCGAGTTTAAAGCGGAGAAGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-353s21c1
Sequence:CCGGTGGTGCCTCCAACGTTGTCTTCTCGAGAAGACAACGTTGGAGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007867.4-435s21c1
Sequence:CCGGACCGCAGCTTCTCCCGATTTGCTCGAGCAAATCGGGAGAAGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks