EMAIL THIS PAGE TO A FRIEND

DLX5

distal-less homeobox 5

110 Gene Product Result for
Synonyms: SHFM1D
UniProtKB ID: P56178, Q9UPL1
Gene ID:
Human(1749) Summary: This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. The encoded protein may play a role in bone development and fracture healing. Mutation in this gene, which is located in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7, may be associated with split-hand/split-foot malformation. [provided by RefSeq, Jul 2008]
Mouse(13395) distal-less homeobox 5
Rat(25431) distal-less homeobox 5
chicken(373969) distal-less homeobox 5
dog(482313) distal-less homeobox 5
cow(507415) distal-less homeobox 5
domestic cat(101094996) distal-less homeobox 5
naked mole-rat(101701453) distal-less homeobox 5
domestic guinea pig(100736137) distal-less homeobox 5
sheep(101119298) distal-less homeobox 5
Domestic Rabbit(100008630) distal-less homeobox 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38586 Anti-DLX5 (AB1) antibody produced in rabbit IgG fraction of antiserum human, canine, horse, rabbit, rat, mouse, guinea pig, bovine, pig
western blot pricing
AV38585 Anti-DLX5 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, rat, horse, pig, guinea pig, rabbit, canine, human, bovine
immunohistochemistry, western blot pricing
GW22362A Anti-DLX5 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
SAB2501236 Anti-DLX5 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
SAB1412173 ANTI-DLX5 antibody produced in mouse clone 4F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412288 ANTI-DLX5 antibody produced in mouse clone 4C6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412489 ANTI-DLX5 antibody produced in mouse clone 1B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412490 ANTI-DLX5 antibody produced in mouse clone 3F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412491 ANTI-DLX5 antibody produced in mouse clone 4H6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412492 ANTI-DLX5 antibody produced in mouse clone 2B6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412664 ANTI-DLX5 antibody produced in mouse clone 4B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA005670 Anti-DLX5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV32867 Anti-DLX5 antibody produced in rabbit affinity isolated antibody zebrafish, mouse, guinea pig, rat, canine, rabbit, sheep, horse, human
immunohistochemistry, western blot pricing
SAB4500660 Anti-DLX5 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB2103442 Anti-DLX5, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, human, rat, pig, canine, mouse, horse, guinea pig, rabbit
western blot pricing
WH0001749M12 Monoclonal Anti-DLX5 antibody produced in mouse clone 3B11, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
SAB1403741 Monoclonal Anti-DLX5, (N-terminal) antibody produced in mouse clone 1B3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010056 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010056 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010056 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005221 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022041 MISSION® esiRNA esiRNA human DLX5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005221 Rosetta Predictions human pricing
NM_012943 Rosetta Predictions rat pricing
NM_010056 Rosetta Predictions mouse pricing
NM_198854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175106 predicted 656
2 SASI_Hs01_00175107 predicted 308
3 SASI_Hs01_00175108 predicted 614
4 SASI_Hs01_00175109 predicted 645
5 SASI_Hs01_00175110 predicted 545
6 SASI_Hs01_00175111 predicted 391
7 SASI_Hs01_00175112 predicted 465
8 SASI_Hs01_00175113 predicted 663
9 SASI_Hs01_00175114 predicted 831
10 SASI_Hs01_00175115 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055999 predicted 626
2 SASI_Rn01_00056000 predicted 579
3 SASI_Rn01_00056001 predicted 593
4 SASI_Rn01_00056003 predicted 607
5 SASI_Rn01_00056004 predicted 702
6 SASI_Rn01_00056006 predicted 371
7 SASI_Rn02_00260510 predicted 339
8 SASI_Rn01_00056007 predicted 543
9 SASI_Rn01_00056008 predicted 803
10 SASI_Rn02_00260511 predicted 810
11 SASI_Rn01_00056002 predicted 565
12 SASI_Rn01_00056005 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317698 predicted 624
2 SASI_Mm02_00317699 predicted 589
3 SASI_Mm01_00172500 predicted 855
4 SASI_Mm02_00317700 predicted 681
5 SASI_Mm02_00317701 predicted 602
6 SASI_Mm02_00317702 predicted 559
7 SASI_Mm02_00317703 predicted 613
8 SASI_Mm02_00317704 predicted 709
9 SASI_Mm02_00317705 predicted 812
10 SASI_Mm01_00172506 predicted 814
11 SASI_Mm01_00172499 predicted 301
12 SASI_Mm01_00172501 predicted 308
13 SASI_Mm01_00172502 predicted 299
14 SASI_Mm01_00172503 predicted 310
15 SASI_Mm01_00172504 predicted 311
16 SASI_Mm01_00172505 predicted 292
17 SASI_Mm01_00172507 predicted 827
18 SASI_Mm01_00172508 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179471 predicted 294
2 SASI_Mm01_00179472 predicted 780
3 SASI_Mm01_00179473 predicted 300
4 SASI_Mm01_00179474 predicted 296
5 SASI_Mm01_00179475 predicted 300
6 SASI_Mm01_00179476 predicted 298
7 SASI_Mm01_00179477 predicted 293
8 SASI_Mm01_00179478 predicted 735
9 SASI_Mm01_00179479 predicted 734
10 SASI_Mm01_00179480 predicted 815
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010056
DLX5 MISSION shRNA Bacterial Glycerol Stock
distal-less homeobox 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010056.2-1096s21c1
Sequence:CCGGGCTGGTTTAGAAATCAGAAAGCTCGAGCTTTCTGATTTCTAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010056.2-1045s21c1
Sequence:CCGGTTTATTAGATGGGCTACTTTCCTCGAGGAAAGTAGCCCATCTAATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-630s1c1
Sequence:CCGGGCCGCTTTACAGAGAAGGTTTCTCGAGAAACCTTCTCTGTAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-590s1c1
Sequence:CCGGAGTTCGTAAACCCAGGACTATCTCGAGATAGTCCTGGGTTTACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-570s1c1
Sequence:CCGGGTGAATGGTAAACCAAAGAAACTCGAGTTTCTTTGGTTTACCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-307s1c1
Sequence:CCGGCCACCGATTCTGACTACTACACTCGAGTGTAGTAGTCAGAATCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-974s1c1
Sequence:CCGGCAGCTCAATCAATTCCCACCTCTCGAGAGGTGGGAATTGATTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010056
DLX5 MISSION shRNA shRNA Plasmid DNA
distal-less homeobox 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010056.2-1096s21c1
Sequence:CCGGGCTGGTTTAGAAATCAGAAAGCTCGAGCTTTCTGATTTCTAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010056.2-1045s21c1
Sequence:CCGGTTTATTAGATGGGCTACTTTCCTCGAGGAAAGTAGCCCATCTAATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-630s1c1
Sequence:CCGGGCCGCTTTACAGAGAAGGTTTCTCGAGAAACCTTCTCTGTAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-590s1c1
Sequence:CCGGAGTTCGTAAACCCAGGACTATCTCGAGATAGTCCTGGGTTTACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-570s1c1
Sequence:CCGGGTGAATGGTAAACCAAAGAAACTCGAGTTTCTTTGGTTTACCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-307s1c1
Sequence:CCGGCCACCGATTCTGACTACTACACTCGAGTGTAGTAGTCAGAATCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-974s1c1
Sequence:CCGGCAGCTCAATCAATTCCCACCTCTCGAGAGGTGGGAATTGATTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010056
DLX5 MISSION shRNA Lentiviral Transduction Particles
distal-less homeobox 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010056.2-1096s21c1
Sequence:CCGGGCTGGTTTAGAAATCAGAAAGCTCGAGCTTTCTGATTTCTAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010056.2-1045s21c1
Sequence:CCGGTTTATTAGATGGGCTACTTTCCTCGAGGAAAGTAGCCCATCTAATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-630s1c1
Sequence:CCGGGCCGCTTTACAGAGAAGGTTTCTCGAGAAACCTTCTCTGTAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-590s1c1
Sequence:CCGGAGTTCGTAAACCCAGGACTATCTCGAGATAGTCCTGGGTTTACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-570s1c1
Sequence:CCGGGTGAATGGTAAACCAAAGAAACTCGAGTTTCTTTGGTTTACCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-307s1c1
Sequence:CCGGCCACCGATTCTGACTACTACACTCGAGTGTAGTAGTCAGAATCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010056.2-974s1c1
Sequence:CCGGCAGCTCAATCAATTCCCACCTCTCGAGAGGTGGGAATTGATTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005221
DLX5 MISSION shRNA Bacterial Glycerol Stock
distal-less homeobox 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005221.5-644s21c1
Sequence:CCGGAGCTTTCAGCTGGCCGCATTACTCGAGTAATGCGGCCAGCTGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005221.5-582s21c1
Sequence:CCGGCCGAGGTGAGAATGGTGAATGCTCGAGCATTCACCATTCTCACCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005221.4-1280s1c1
Sequence:CCGGCTTTCAATGGTGCCTTGAAATCTCGAGATTTCAAGGCACCATTGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005221.4-321s1c1
Sequence:CCGGCCGAGTCTTCAGCTACCGATTCTCGAGAATCGGTAGCTGAAGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005221.4-473s1c1
Sequence:CCGGGCCAAAGCTTATGCCGACTATCTCGAGATAGTCGGCATAAGCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005221.4-604s1c1
Sequence:CCGGCAAACCAAAGAAAGTTCGTAACTCGAGTTACGAACTTTCTTTGGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005221.4-298s1c1
Sequence:CCGGGTCTCAGGAATCGCCAACTTTCTCGAGAAAGTTGGCGATTCCTGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005221
DLX5 MISSION shRNA shRNA Plasmid DNA
distal-less homeobox 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005221.5-644s21c1
Sequence:CCGGAGCTTTCAGCTGGCCGCATTACTCGAGTAATGCGGCCAGCTGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005221.5-582s21c1
Sequence:CCGGCCGAGGTGAGAATGGTGAATGCTCGAGCATTCACCATTCTCACCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005221.4-1280s1c1
Sequence:CCGGCTTTCAATGGTGCCTTGAAATCTCGAGATTTCAAGGCACCATTGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005221.4-321s1c1
Sequence:CCGGCCGAGTCTTCAGCTACCGATTCTCGAGAATCGGTAGCTGAAGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005221.4-473s1c1
Sequence:CCGGGCCAAAGCTTATGCCGACTATCTCGAGATAGTCGGCATAAGCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005221.4-604s1c1
Sequence:CCGGCAAACCAAAGAAAGTTCGTAACTCGAGTTACGAACTTTCTTTGGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005221.4-298s1c1
Sequence:CCGGGTCTCAGGAATCGCCAACTTTCTCGAGAAAGTTGGCGATTCCTGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005221
DLX5 MISSION shRNA Lentiviral Transduction Particles
distal-less homeobox 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005221.5-644s21c1
Sequence:CCGGAGCTTTCAGCTGGCCGCATTACTCGAGTAATGCGGCCAGCTGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005221.5-582s21c1
Sequence:CCGGCCGAGGTGAGAATGGTGAATGCTCGAGCATTCACCATTCTCACCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005221.4-1280s1c1
Sequence:CCGGCTTTCAATGGTGCCTTGAAATCTCGAGATTTCAAGGCACCATTGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005221.4-321s1c1
Sequence:CCGGCCGAGTCTTCAGCTACCGATTCTCGAGAATCGGTAGCTGAAGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005221.4-473s1c1
Sequence:CCGGGCCAAAGCTTATGCCGACTATCTCGAGATAGTCGGCATAAGCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005221.4-604s1c1
Sequence:CCGGCAAACCAAAGAAAGTTCGTAACTCGAGTTACGAACTTTCTTTGGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005221.4-298s1c1
Sequence:CCGGGTCTCAGGAATCGCCAACTTTCTCGAGAAAGTTGGCGATTCCTGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks