EMAIL THIS PAGE TO A FRIEND

DLX6-AS1

DLX6 antisense RNA 1

42 Gene Product Result for
Synonyms: DLX6-AS DLX6AS Evf-2 NCRNA00212
Species: Human DLX6-AS1(285987)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_380131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_380131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_380131 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_040145 Rosetta Predictions human pricing
XR_040146 Rosetta Predictions human pricing
XR_040147 Rosetta Predictions human pricing
XR_040148 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516308 predicted 359
2 SASI_Hs02_00516309 predicted 324
3 SASI_Hs02_00516310 predicted 254
4 SASI_Hs02_00516311 predicted 349
5 SASI_Hs02_00516312 predicted 370
6 SASI_Hs02_00516313 predicted 318
7 SASI_Hs02_00516314 predicted 349
8 SASI_Hs02_00516315 predicted 343
9 SASI_Hs02_00516316 predicted 407
10 SASI_Hs02_00516317 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516318 predicted 360
2 SASI_Hs02_00516319 predicted 317
3 SASI_Hs02_00516320 predicted 254
4 SASI_Hs02_00516321 predicted 355
5 SASI_Hs02_00516322 predicted 369
6 SASI_Hs02_00516323 predicted 320
7 SASI_Hs02_00516324 predicted 345
8 SASI_Hs02_00516325 predicted 341
9 SASI_Hs02_00516326 predicted 406
10 SASI_Hs02_00516327 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516328 predicted 358
2 SASI_Hs02_00516329 predicted 321
3 SASI_Hs02_00516330 predicted 260
4 SASI_Hs02_00516331 predicted 347
5 SASI_Hs02_00516332 predicted 368
6 SASI_Hs02_00516333 predicted 318
7 SASI_Hs02_00516334 predicted 349
8 SASI_Hs02_00516335 predicted 340
9 SASI_Hs02_00516336 predicted 406
10 SASI_Hs02_00516337 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516338 predicted 364
2 SASI_Hs02_00516339 predicted 323
3 SASI_Hs02_00516340 predicted 260
4 SASI_Hs02_00516341 predicted 355
5 SASI_Hs02_00516342 predicted 366
6 SASI_Hs02_00516343 predicted 317
7 SASI_Hs02_00516344 predicted 348
8 SASI_Hs02_00516345 predicted 342
9 SASI_Hs02_00516346 predicted 405
10 SASI_Hs02_00516347 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_380131
DLX6-AS1 MISSION shRNA Bacterial Glycerol Stock
DLX6 antisense RNA 1
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000122651    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_380131.1-2805s1c1
Sequence:CCGGGCCTTGAGATACACATCAGATCTCGAGATCTGATGTGTATCTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_380131
DLX6-AS1 MISSION shRNA shRNA Plasmid DNA
DLX6 antisense RNA 1
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000122651    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_380131.1-2805s1c1
Sequence:CCGGGCCTTGAGATACACATCAGATCTCGAGATCTGATGTGTATCTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_380131
DLX6-AS1 MISSION shRNA Lentiviral Transduction Particles
DLX6 antisense RNA 1
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000122651    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_380131.1-2805s1c1
Sequence:CCGGGCCTTGAGATACACATCAGATCTCGAGATCTGATGTGTATCTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks