EMAIL THIS PAGE TO A FRIEND

DLX6

distal-less homeobox 6

115 Gene Product Result for
UniProtKB ID: P56179, A4D1I2, B3KSQ0, J3KR92, Q3ZAR6, Q9UPL2
Gene ID:
Human(1750) Summary: This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. This family is comprised of at least 6 different members that encode proteins with roles in forebrain and craniofacial development. This gene is in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7. [provided by RefSeq, Jul 2008]
Mouse(13396) distal-less homeobox 6
Rat(500023) distal-less homeobox 6
chicken(772070) distal-less homeobox 6
cow(786461) distal-less homeobox 6
domestic cat(101098212) distal-less homeobox 6
domestic guinea pig(100735853) distal-less homeobox 6
naked mole-rat(101701087) distal-less homeobox 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376652 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_379892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_379892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_379892 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005222 Rosetta Predictions human pricing
XM_575377 Rosetta Predictions rat pricing
NM_010057 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064134 predicted 558
2 SASI_Hs01_00064136 predicted 599
3 SASI_Hs01_00064137 predicted 512
4 SASI_Hs01_00064138 predicted 454
5 SASI_Hs01_00064139 predicted 474
6 SASI_Hs01_00064140 predicted 588
7 SASI_Hs01_00064141 predicted 483
8 SASI_Hs01_00064142 predicted 675
9 SASI_Hs02_00339208 predicted 512
10 SASI_Hs02_00339209 predicted 600
11 SASI_Hs01_00064133 predicted 465
12 SASI_Hs01_00064135 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575377 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403591 predicted 505
2 SASI_Rn02_00403592 predicted 494
3 SASI_Rn02_00403593 predicted 402
4 SASI_Rn02_00403594 predicted 643
5 SASI_Rn02_00403595 predicted 407
6 SASI_Rn02_00403596 predicted 534
7 SASI_Rn02_00403597 predicted 394
8 SASI_Rn02_00403598 predicted 412
9 SASI_Rn02_00403599 predicted 529
10 SASI_Rn02_00403600 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317706 predicted 607
2 SASI_Mm02_00317707 predicted 739
3 SASI_Mm02_00317708 predicted 702
4 SASI_Mm02_00317709 predicted 712
5 SASI_Mm02_00317710 predicted 601
6 SASI_Mm02_00317711 predicted 731
7 SASI_Mm02_00317712 predicted 696
8 SASI_Mm02_00317713 predicted 694
9 SASI_Mm02_00317714 predicted 594
10 SASI_Mm02_00317715 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376652
DLX6 MISSION shRNA Bacterial Glycerol Stock
distal-less homeobox 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-348s1c1
Sequence:CCGGCCAGGCTTTAAACCATCGCTTCTCGAGAAGCGATGGTTTAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-415s1c1
Sequence:CCGGGCTTCCTTAGGACTGACACAACTCGAGTTGTGTCAGTCCTAAGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-484s1c1
Sequence:CCGGCTGCTGAAGCAGGGCAGTAATCTCGAGATTACTGCCCTGCTTCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-364s1c1
Sequence:CCGGCGCTTTCAGCAGACACAGTATCTCGAGATACTGTGTCTGCTGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-627s1c1
Sequence:CCGGGCCTGGCTATTCTCACTGGTACTCGAGTACCAGTGAGAATAGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376652
DLX6 MISSION shRNA shRNA Plasmid DNA
distal-less homeobox 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-348s1c1
Sequence:CCGGCCAGGCTTTAAACCATCGCTTCTCGAGAAGCGATGGTTTAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-415s1c1
Sequence:CCGGGCTTCCTTAGGACTGACACAACTCGAGTTGTGTCAGTCCTAAGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-484s1c1
Sequence:CCGGCTGCTGAAGCAGGGCAGTAATCTCGAGATTACTGCCCTGCTTCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-364s1c1
Sequence:CCGGCGCTTTCAGCAGACACAGTATCTCGAGATACTGTGTCTGCTGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-627s1c1
Sequence:CCGGGCCTGGCTATTCTCACTGGTACTCGAGTACCAGTGAGAATAGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376652
DLX6 MISSION shRNA Lentiviral Transduction Particles
distal-less homeobox 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-348s1c1
Sequence:CCGGCCAGGCTTTAAACCATCGCTTCTCGAGAAGCGATGGTTTAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-415s1c1
Sequence:CCGGGCTTCCTTAGGACTGACACAACTCGAGTTGTGTCAGTCCTAAGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-484s1c1
Sequence:CCGGCTGCTGAAGCAGGGCAGTAATCTCGAGATTACTGCCCTGCTTCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-364s1c1
Sequence:CCGGCGCTTTCAGCAGACACAGTATCTCGAGATACTGTGTCTGCTGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376652.1-627s1c1
Sequence:CCGGGCCTGGCTATTCTCACTGGTACTCGAGTACCAGTGAGAATAGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_379892
DLX6 MISSION shRNA Bacterial Glycerol Stock
distal-less homeobox 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-453s1c1
Sequence:CCGGGTTTCAGAACAAACGCTCTAACTCGAGTTAGAGCGTTTGTTCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-669s1c1
Sequence:CCGGGATGCAGAGACCACAGATGATCTCGAGATCATCTGTGGTCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-462s1c1
Sequence:CCGGCAAACGCTCTAAGTTTAAGAACTCGAGTTCTTAAACTTAGAGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-436s1c1
Sequence:CCGGACACAGGTGAAGATATGGTTTCTCGAGAAACCATATCTTCACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-617s1c1
Sequence:CCGGACAGCTACATGCCTGGCTATTCTCGAGAATAGCCAGGCATGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_379892
DLX6 MISSION shRNA shRNA Plasmid DNA
distal-less homeobox 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-453s1c1
Sequence:CCGGGTTTCAGAACAAACGCTCTAACTCGAGTTAGAGCGTTTGTTCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-669s1c1
Sequence:CCGGGATGCAGAGACCACAGATGATCTCGAGATCATCTGTGGTCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-462s1c1
Sequence:CCGGCAAACGCTCTAAGTTTAAGAACTCGAGTTCTTAAACTTAGAGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-436s1c1
Sequence:CCGGACACAGGTGAAGATATGGTTTCTCGAGAAACCATATCTTCACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-617s1c1
Sequence:CCGGACAGCTACATGCCTGGCTATTCTCGAGAATAGCCAGGCATGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_379892
DLX6 MISSION shRNA Lentiviral Transduction Particles
distal-less homeobox 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-453s1c1
Sequence:CCGGGTTTCAGAACAAACGCTCTAACTCGAGTTAGAGCGTTTGTTCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-669s1c1
Sequence:CCGGGATGCAGAGACCACAGATGATCTCGAGATCATCTGTGGTCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-462s1c1
Sequence:CCGGCAAACGCTCTAAGTTTAAGAACTCGAGTTCTTAAACTTAGAGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-436s1c1
Sequence:CCGGACACAGGTGAAGATATGGTTTCTCGAGAAACCATATCTTCACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379892.1-617s1c1
Sequence:CCGGACAGCTACATGCCTGGCTATTCTCGAGAATAGCCAGGCATGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010057
DLX6 MISSION shRNA Bacterial Glycerol Stock
distal-less homeobox 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-705s21c1
Sequence:CCGGAGAATAAGCGCTCTAAGTTTACTCGAGTAAACTTAGAGCGCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-731s21c1
Sequence:CCGGTTGCTGAAGCAGGGTAGTAACCTCGAGGTTACTACCCTGCTTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-559s21c1
Sequence:CCGGTCGGAAGCCTCGGACCATTTACTCGAGTAAATGGTCCGAGGCTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-610s21c1
Sequence:CCGGTCGCTTTCAGCAGACTCAATACTCGAGTATTGAGTCTGCTGAAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-586s21c1
Sequence:CCGGCCTGCAGCTCCAGGCTTTAAACTCGAGTTTAAAGCCTGGAGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010057
DLX6 MISSION shRNA shRNA Plasmid DNA
distal-less homeobox 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-705s21c1
Sequence:CCGGAGAATAAGCGCTCTAAGTTTACTCGAGTAAACTTAGAGCGCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-731s21c1
Sequence:CCGGTTGCTGAAGCAGGGTAGTAACCTCGAGGTTACTACCCTGCTTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-559s21c1
Sequence:CCGGTCGGAAGCCTCGGACCATTTACTCGAGTAAATGGTCCGAGGCTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-610s21c1
Sequence:CCGGTCGCTTTCAGCAGACTCAATACTCGAGTATTGAGTCTGCTGAAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-586s21c1
Sequence:CCGGCCTGCAGCTCCAGGCTTTAAACTCGAGTTTAAAGCCTGGAGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010057
DLX6 MISSION shRNA Lentiviral Transduction Particles
distal-less homeobox 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-705s21c1
Sequence:CCGGAGAATAAGCGCTCTAAGTTTACTCGAGTAAACTTAGAGCGCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-731s21c1
Sequence:CCGGTTGCTGAAGCAGGGTAGTAACCTCGAGGTTACTACCCTGCTTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-559s21c1
Sequence:CCGGTCGGAAGCCTCGGACCATTTACTCGAGTAAATGGTCCGAGGCTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-610s21c1
Sequence:CCGGTCGCTTTCAGCAGACTCAATACTCGAGTATTGAGTCTGCTGAAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010057.1-586s21c1
Sequence:CCGGCCTGCAGCTCCAGGCTTTAAACTCGAGTTTAAAGCCTGGAGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks