EMAIL THIS PAGE TO A FRIEND

DMAP1

DNA methyltransferase 1 associated protein 1

78 Gene Product Result for
Synonyms: DNMAP1 DNMTAP1 EAF2 MEAF2 SWC4
Gene ID:
Human(55929) Summary: This gene encodes a subunit of several, distinct complexes involved in the repression or activation of transcription. The encoded protein can independently repress transcription and is targeted to replication foci throughout S phase by interacting directly with the N-terminus of DNA methyltransferase 1. During late S phase, histone deacetylase 2 is added to this complex, providing a means to deacetylate histones in transcriptionally inactive heterochromatin following replication. The encoded protein is also a component of the nucleosome acetyltransferase of H4 complex and interacts with the transcriptional corepressor tumor susceptibility gene 101 and the pro-apoptotic death-associated protein 6, among others. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
Mouse(66233) DNA methyltransferase 1-associated protein 1
Rat(298447) DNA methyltransferase 1-associated protein 1
Zebrafish(393225) DNA methyltransferase 1 associated protein 1
cow(508127) DNA methyltransferase 1 associated protein 1
domestic cat(101085736) DNA methyltransferase 1 associated protein 1
dog(475385) DNA methyltransferase 1 associated protein 1
chicken(424578) DNA methyltransferase 1 associated protein 1
fruit fly(37339) CG11132 gene product from transcript CG11132-RA
sheep(101115583) DNA methyltransferase 1 associated protein 1
Domestic Rabbit(100350915) DNA methyltransferase 1 associated protein 1
naked mole-rat(101725928) DNA methyltransferase 1 associated protein 1
domestic guinea pig(100720826) DNA methyltransferase 1 associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32917 Anti-DMAP1 (AB1) antibody produced in rabbit IgG fraction of antiserum human, zebrafish, mouse, canine, rat, guinea pig, bovine, horse, rabbit
western blot pricing
AV39380 Anti-DMAP1 (AB2) antibody produced in rabbit IgG fraction of antiserum horse, mouse, rat, canine, bovine, human, guinea pig, rabbit
western blot pricing
AV39381 Anti-DMAP1 (AB3) antibody produced in rabbit IgG fraction of antiserum human, rat, canine, zebrafish, mouse, rabbit, bovine, guinea pig
western blot pricing
SAB1409516 Anti-DMAP1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412429 ANTI-DMAP1 antibody produced in mouse clone 1A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA028419 Anti-DMAP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
PLA0067 Goat anti-DMAP1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gorilla, chimpanzee, human, primate, rhesus monkey, gibbon, marmoset
proximity ligation assay, western blot pricing
WH0055929M1 Monoclonal Anti-DMAP1 antibody produced in mouse clone 2G12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1405177 Monoclonal Anti-DMAP1, (N-terminal) antibody produced in mouse clone 5H4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019100 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034023 Rosetta Predictions human pricing
NM_001034024 Rosetta Predictions human pricing
NM_019100 Rosetta Predictions human pricing
NM_001015006 Rosetta Predictions rat pricing
NM_023178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080305 predicted 641
2 SASI_Hs01_00080306 predicted 1040
3 SASI_Hs01_00080307 predicted 778
4 SASI_Hs01_00080308 predicted 1039
5 SASI_Hs02_00308122 predicted 371
6 SASI_Hs01_00080309 predicted 744
7 SASI_Hs01_00080310 predicted 438
8 SASI_Hs01_00080311 predicted 866
9 SASI_Hs01_00080312 predicted 749
10 SASI_Hs01_00080313 predicted 856
11 SASI_Hs01_00080314 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214288 predicted 602
2 SASI_Hs01_00214289 predicted 997
3 SASI_Hs01_00214290 predicted 744
4 SASI_Hs01_00214291 predicted 996
5 SASI_Hs02_00308123 predicted 331
6 SASI_Hs01_00214292 predicted 709
7 SASI_Hs01_00214293 predicted 398
8 SASI_Hs01_00214294 predicted 830
9 SASI_Hs01_00214295 predicted 707
10 SASI_Hs01_00214296 predicted 818
11 SASI_Hs01_00214297 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165394 predicted 830
2 SASI_Hs01_00165395 predicted 1221
3 SASI_Hs01_00165396 predicted 961
4 SASI_Hs01_00165397 predicted 1217
5 SASI_Hs02_00352719 predicted 546
6 SASI_Hs01_00165398 predicted 934
7 SASI_Hs01_00165399 predicted 615
8 SASI_Hs01_00165400 predicted 1046
9 SASI_Hs01_00165401 predicted 928
10 SASI_Hs01_00165402 predicted 1031
11 SASI_Hs01_00165403 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201931 predicted 1016
2 SASI_Rn02_00201932 predicted 577
3 SASI_Rn02_00201933 predicted 638
4 SASI_Rn02_00201934 predicted 260
5 SASI_Rn02_00201935 predicted 572
6 SASI_Rn02_00201936 predicted 1174
7 SASI_Rn02_00201937 predicted 409
8 SASI_Rn02_00201938 predicted 267
9 SASI_Rn02_00201939 predicted 791
10 SASI_Rn02_00201940 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187088 predicted 513
2 SASI_Mm01_00187089 predicted 206
3 SASI_Mm02_00326900 predicted 1123
4 SASI_Mm02_00326901 predicted 802
5 SASI_Mm01_00187090 predicted 332
6 SASI_Mm01_00187091 predicted 220
7 SASI_Mm01_00187092 predicted 739
8 SASI_Mm02_00326902 predicted 859
9 SASI_Mm01_00187095 predicted 551
10 SASI_Mm01_00187096 predicted 367
11 SASI_Mm01_00187093 predicted 590
12 SASI_Mm01_00187094 predicted 332
13 SASI_Mm01_00187097 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023178
VALIDATED
DMAP1 MISSION shRNA Bacterial Glycerol Stock
DNA methyltransferase 1 associated protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023178.2-1351s1c1
Sequence:CCGGCCCACCAAGGATACCATCATTCTCGAGAATGATGGTATCCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023178.2-565s1c1
Sequence:CCGGCGCTTCGTAGTTATTCACGATCTCGAGATCGTGAATAACTACGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023178.2-231s1c1
Sequence:CCGGTGCTTTGCTTTACTCTGACAACTCGAGTTGTCAGAGTAAAGCAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023178.2-520s1c1
Sequence:CCGGGCAGAGACTGACCACCTATTTCTCGAGAAATAGGTGGTCAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023178.2-682s1c1
Sequence:CCGGCCAGGCACAGATCTCAAGATACTCGAGTATCTTGAGATCTGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-231s21c1
Sequence:CCGGTGCTTTGCTTTACTCTGACAACTCGAGTTGTCAGAGTAAAGCAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-981s21c1
Sequence:CCGGAGGCATCAAGTTTCCAGATTTCTCGAGAAATCTGGAAACTTGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-520s21c1
Sequence:CCGGGCAGAGACTGACCACCTATTTCTCGAGAAATAGGTGGTCAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-800s21c1
Sequence:CCGGTACAGGAGCTGCGTAAGATTGCTCGAGCAATCTTACGCAGCTCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-739s21c1
Sequence:CCGGGAACAGCTAGAGCGGCTTTACCTCGAGGTAAAGCCGCTCTAGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023178
VALIDATED
DMAP1 MISSION shRNA shRNA Plasmid DNA
DNA methyltransferase 1 associated protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023178.2-1351s1c1
Sequence:CCGGCCCACCAAGGATACCATCATTCTCGAGAATGATGGTATCCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023178.2-565s1c1
Sequence:CCGGCGCTTCGTAGTTATTCACGATCTCGAGATCGTGAATAACTACGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023178.2-231s1c1
Sequence:CCGGTGCTTTGCTTTACTCTGACAACTCGAGTTGTCAGAGTAAAGCAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023178.2-520s1c1
Sequence:CCGGGCAGAGACTGACCACCTATTTCTCGAGAAATAGGTGGTCAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023178.2-682s1c1
Sequence:CCGGCCAGGCACAGATCTCAAGATACTCGAGTATCTTGAGATCTGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-231s21c1
Sequence:CCGGTGCTTTGCTTTACTCTGACAACTCGAGTTGTCAGAGTAAAGCAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-981s21c1
Sequence:CCGGAGGCATCAAGTTTCCAGATTTCTCGAGAAATCTGGAAACTTGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-520s21c1
Sequence:CCGGGCAGAGACTGACCACCTATTTCTCGAGAAATAGGTGGTCAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-800s21c1
Sequence:CCGGTACAGGAGCTGCGTAAGATTGCTCGAGCAATCTTACGCAGCTCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-739s21c1
Sequence:CCGGGAACAGCTAGAGCGGCTTTACCTCGAGGTAAAGCCGCTCTAGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023178
VALIDATED
DMAP1 MISSION shRNA Lentiviral Transduction Particles
DNA methyltransferase 1 associated protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023178.2-1351s1c1
Sequence:CCGGCCCACCAAGGATACCATCATTCTCGAGAATGATGGTATCCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023178.2-565s1c1
Sequence:CCGGCGCTTCGTAGTTATTCACGATCTCGAGATCGTGAATAACTACGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023178.2-231s1c1
Sequence:CCGGTGCTTTGCTTTACTCTGACAACTCGAGTTGTCAGAGTAAAGCAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023178.2-520s1c1
Sequence:CCGGGCAGAGACTGACCACCTATTTCTCGAGAAATAGGTGGTCAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023178.2-682s1c1
Sequence:CCGGCCAGGCACAGATCTCAAGATACTCGAGTATCTTGAGATCTGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-231s21c1
Sequence:CCGGTGCTTTGCTTTACTCTGACAACTCGAGTTGTCAGAGTAAAGCAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-981s21c1
Sequence:CCGGAGGCATCAAGTTTCCAGATTTCTCGAGAAATCTGGAAACTTGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-520s21c1
Sequence:CCGGGCAGAGACTGACCACCTATTTCTCGAGAAATAGGTGGTCAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-800s21c1
Sequence:CCGGTACAGGAGCTGCGTAAGATTGCTCGAGCAATCTTACGCAGCTCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023178.2-739s21c1
Sequence:CCGGGAACAGCTAGAGCGGCTTTACCTCGAGGTAAAGCCGCTCTAGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019100
VALIDATED
DMAP1 MISSION shRNA Bacterial Glycerol Stock
DNA methyltransferase 1 associated protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_019100.3-693s1c1
Sequence:CCGGCAGCTTTATCTCCACGATGATCTCGAGATCATCGTGGAGATAAAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_019100.3-440s1c1
Sequence:CCGGCTTGCTCTACTCTGACAAGAACTCGAGTTCTTGTCAGAGTAGAGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019100.3-1557s1c1
Sequence:CCGGCCCAAGGACACCATCATTGATCTCGAGATCAATGATGGTGTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019100.3-542s1c1
Sequence:CCGGGCCTTGGAAGTGGATGCCATTCTCGAGAATGGCATCCACTTCCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019100.4-743s21c1
Sequence:CCGGCACGATGATGCTTGGACTAAGCTCGAGCTTAGTCCAAGCATCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019100.4-935s21c1
Sequence:CCGGGACCTTAAGATACCAGTATTTCTCGAGAAATACTGGTATCTTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_019100.4-374s21c1
Sequence:CCGGATCAGCAAGAAGGACATTATCCTCGAGGATAATGTCCTTCTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019100.4-1044s21c1
Sequence:CCGGTACAGGAGCTGCGCAAGATTGCTCGAGCAATCTTGCGCAGCTCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019100
VALIDATED
DMAP1 MISSION shRNA shRNA Plasmid DNA
DNA methyltransferase 1 associated protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_019100.3-693s1c1
Sequence:CCGGCAGCTTTATCTCCACGATGATCTCGAGATCATCGTGGAGATAAAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_019100.3-440s1c1
Sequence:CCGGCTTGCTCTACTCTGACAAGAACTCGAGTTCTTGTCAGAGTAGAGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019100.3-1557s1c1
Sequence:CCGGCCCAAGGACACCATCATTGATCTCGAGATCAATGATGGTGTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019100.3-542s1c1
Sequence:CCGGGCCTTGGAAGTGGATGCCATTCTCGAGAATGGCATCCACTTCCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019100.4-743s21c1
Sequence:CCGGCACGATGATGCTTGGACTAAGCTCGAGCTTAGTCCAAGCATCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019100.4-935s21c1
Sequence:CCGGGACCTTAAGATACCAGTATTTCTCGAGAAATACTGGTATCTTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_019100.4-374s21c1
Sequence:CCGGATCAGCAAGAAGGACATTATCCTCGAGGATAATGTCCTTCTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019100.4-1044s21c1
Sequence:CCGGTACAGGAGCTGCGCAAGATTGCTCGAGCAATCTTGCGCAGCTCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019100
VALIDATED
DMAP1 MISSION shRNA Lentiviral Transduction Particles
DNA methyltransferase 1 associated protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_019100.3-693s1c1
Sequence:CCGGCAGCTTTATCTCCACGATGATCTCGAGATCATCGTGGAGATAAAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_019100.3-440s1c1
Sequence:CCGGCTTGCTCTACTCTGACAAGAACTCGAGTTCTTGTCAGAGTAGAGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019100.3-1557s1c1
Sequence:CCGGCCCAAGGACACCATCATTGATCTCGAGATCAATGATGGTGTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019100.3-542s1c1
Sequence:CCGGGCCTTGGAAGTGGATGCCATTCTCGAGAATGGCATCCACTTCCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019100.4-743s21c1
Sequence:CCGGCACGATGATGCTTGGACTAAGCTCGAGCTTAGTCCAAGCATCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019100.4-935s21c1
Sequence:CCGGGACCTTAAGATACCAGTATTTCTCGAGAAATACTGGTATCTTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_019100.4-374s21c1
Sequence:CCGGATCAGCAAGAAGGACATTATCCTCGAGGATAATGTCCTTCTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019100.4-1044s21c1
Sequence:CCGGTACAGGAGCTGCGCAAGATTGCTCGAGCAATCTTGCGCAGCTCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks