EMAIL THIS PAGE TO A FRIEND

DMBT1

deleted in malignant brain tumors 1

93 Gene Product Result for
Synonyms: GP340 muclin
Gene ID:
Human(1755) Summary: Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. The gene DMBT1 was originally isolated based on its deletion in a medulloblastoma cell line. DMBT1 is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The DMBT1 protein is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor supressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Jul 2008]
Mouse(12945) deleted in malignant brain tumors 1
Rat(170568) deleted in malignant brain tumors 1
domestic guinea pig(100715944) deleted in malignant brain tumors 1
naked mole-rat(101702699) deleted in malignant brain tumors 1
Domestic Rabbit(100008679) deleted in malignant brain tumors 1
chicken(426819) deleted in malignant brain tumors 1
dog(486922) deleted in malignant brain tumors 1
domestic cat(101096171) deleted in malignant brain tumors 1
cow(404104) deleted in malignant brain tumors 1
Horse(100064515) deleted in malignant brain tumors 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004406 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004406 siRNAs that have been validated in the lab human pricing
NM_007329 Rosetta Predictions human pricing
NM_017579 Rosetta Predictions human pricing
XM_001080554 Rosetta Predictions rat pricing
XM_577842 Rosetta Predictions rat pricing
NM_007769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004406 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027048 validated 3092
2 SASI_Hs01_00027046 predicted 3512
3 SASI_Hs01_00027053 predicted 2057
4 SASI_Hs02_00337537 predicted 1062
5 SASI_Hs02_00337538 predicted 392
6 SASI_Hs01_00027050 predicted 4137
7 SASI_Hs02_00337539 predicted 3005
8 SASI_Hs02_00337540 predicted 1730
9 SASI_Hs01_00027051 predicted 4283
10 SASI_Hs01_00027047 predicted 3615
11 SASI_Hs01_00027049 predicted 691
12 SASI_Hs01_00027052 predicted 3784
13 SASI_Hs01_00027054 predicted 2846
14 SASI_Hs01_00027055 predicted 3701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175970 predicted 5390
2 SASI_Hs01_00175977 predicted 3557
3 SASI_Hs02_00343405 predicted 1059
4 SASI_Hs02_00343406 predicted 386
5 SASI_Hs01_00175974 predicted 6024
6 SASI_Hs02_00343407 predicted 4891
7 SASI_Hs02_00343408 predicted 3229
8 SASI_Hs01_00175975 predicted 6163
9 SASI_Hs01_00175971 predicted 5501
10 SASI_Hs01_00175972 predicted 4977
11 SASI_Hs01_00175973 predicted 690
12 SASI_Hs01_00175976 predicted 5674
13 SASI_Hs01_00175978 predicted 4727
14 SASI_Hs01_00175979 predicted 5583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151492 predicted 5364
2 SASI_Hs01_00151499 predicted 3528
3 SASI_Hs02_00350238 predicted 1059
4 SASI_Hs02_00350239 predicted 389
5 SASI_Hs01_00151496 predicted 5985
6 SASI_Hs02_00350240 predicted 4856
7 SASI_Hs02_00350241 predicted 3201
8 SASI_Hs01_00151497 predicted 6139
9 SASI_Hs01_00151493 predicted 5470
10 SASI_Hs01_00151494 predicted 4955
11 SASI_Hs01_00151495 predicted 686
12 SASI_Hs01_00151498 predicted 5644
13 SASI_Hs01_00151500 predicted 4699
14 SASI_Hs01_00151501 predicted 5553
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368403 predicted 3513
2 SASI_Rn02_00368404 predicted 2100
3 SASI_Rn02_00368405 predicted 3580
4 SASI_Rn02_00368406 predicted 4092
5 SASI_Rn02_00368407 predicted 3679
6 SASI_Rn02_00368408 predicted 3411
7 SASI_Rn02_00368409 predicted 1323
8 SASI_Rn02_00368410 predicted 2424
9 SASI_Rn02_00368411 predicted 2960
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407188 predicted 4543
2 SASI_Rn02_00407189 predicted 4858
3 SASI_Rn02_00407190 predicted 4226
4 SASI_Rn02_00407191 predicted 4258
5 SASI_Rn02_00407192 predicted 4108
6 SASI_Rn02_00407193 predicted 5069
7 SASI_Rn02_00407194 predicted 779
8 SASI_Rn02_00407195 predicted 4175
9 SASI_Rn02_00407196 predicted 5978
10 SASI_Rn02_00407197 predicted 5149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128768 predicted 5500
2 SASI_Mm01_00128770 predicted 332
3 SASI_Mm01_00128771 predicted 1376
4 SASI_Mm01_00128772 predicted 3771
5 SASI_Mm01_00128773 predicted 5432
6 SASI_Mm01_00128774 predicted 4891
7 SASI_Mm01_00128775 predicted 5088
8 SASI_Mm02_00312403 predicted 4273
9 SASI_Mm02_00312404 predicted 3045
10 SASI_Mm01_00128769 predicted 3432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007769
DMBT1 MISSION shRNA Bacterial Glycerol Stock
deleted in malignant brain tumors 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-5290s21c1
Sequence:CCGGTTGTACCTTCAGGCCGAAATCCTCGAGGATTTCGGCCTGAAGGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-2809s21c1
Sequence:CCGGGGCTGCAACTATGACTATATCCTCGAGGATATAGTCATAGTTGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-5193s21c1
Sequence:CCGGGTATGGCAATTTCGACGTAAACTCGAGTTTACGTCGAAATTGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-2607s21c1
Sequence:CCGGGTTGACTACAACTCCTTATTTCTCGAGAAATAAGGAGTTGTAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-5535s21c1
Sequence:CCGGAGTATGTCGAGCGTATGATACCTCGAGGTATCATACGCTCGACATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007769.1-6430s1c1
Sequence:CCGGCCCAGGATCTATCAGACTGAACTCGAGTTCAGTCTGATAGATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007769.1-4950s1c1
Sequence:CCGGCCTGGGAATTATCCTAATAATCTCGAGATTATTAGGATAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007769.1-4196s1c1
Sequence:CCGGCCCTTCAAACTATCCTAACAACTCGAGTTGTTAGGATAGTTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007769.1-1349s1c1
Sequence:CCGGCGTTCCTGATTATACACCAATCTCGAGATTGGTGTATAATCAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007769.1-3122s1c1
Sequence:CCGGCCCTTCAAACTATCCAAACAACTCGAGTTGTTTGGATAGTTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007769
DMBT1 MISSION shRNA shRNA Plasmid DNA
deleted in malignant brain tumors 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-5290s21c1
Sequence:CCGGTTGTACCTTCAGGCCGAAATCCTCGAGGATTTCGGCCTGAAGGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-2809s21c1
Sequence:CCGGGGCTGCAACTATGACTATATCCTCGAGGATATAGTCATAGTTGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-5193s21c1
Sequence:CCGGGTATGGCAATTTCGACGTAAACTCGAGTTTACGTCGAAATTGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-2607s21c1
Sequence:CCGGGTTGACTACAACTCCTTATTTCTCGAGAAATAAGGAGTTGTAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-5535s21c1
Sequence:CCGGAGTATGTCGAGCGTATGATACCTCGAGGTATCATACGCTCGACATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007769.1-6430s1c1
Sequence:CCGGCCCAGGATCTATCAGACTGAACTCGAGTTCAGTCTGATAGATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007769.1-4950s1c1
Sequence:CCGGCCTGGGAATTATCCTAATAATCTCGAGATTATTAGGATAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007769.1-4196s1c1
Sequence:CCGGCCCTTCAAACTATCCTAACAACTCGAGTTGTTAGGATAGTTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007769.1-1349s1c1
Sequence:CCGGCGTTCCTGATTATACACCAATCTCGAGATTGGTGTATAATCAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007769.1-3122s1c1
Sequence:CCGGCCCTTCAAACTATCCAAACAACTCGAGTTGTTTGGATAGTTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007769
DMBT1 MISSION shRNA Lentiviral Transduction Particles
deleted in malignant brain tumors 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-5290s21c1
Sequence:CCGGTTGTACCTTCAGGCCGAAATCCTCGAGGATTTCGGCCTGAAGGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-2809s21c1
Sequence:CCGGGGCTGCAACTATGACTATATCCTCGAGGATATAGTCATAGTTGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-5193s21c1
Sequence:CCGGGTATGGCAATTTCGACGTAAACTCGAGTTTACGTCGAAATTGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-2607s21c1
Sequence:CCGGGTTGACTACAACTCCTTATTTCTCGAGAAATAAGGAGTTGTAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007769.2-5535s21c1
Sequence:CCGGAGTATGTCGAGCGTATGATACCTCGAGGTATCATACGCTCGACATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007769.1-6430s1c1
Sequence:CCGGCCCAGGATCTATCAGACTGAACTCGAGTTCAGTCTGATAGATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007769.1-4950s1c1
Sequence:CCGGCCTGGGAATTATCCTAATAATCTCGAGATTATTAGGATAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007769.1-4196s1c1
Sequence:CCGGCCCTTCAAACTATCCTAACAACTCGAGTTGTTAGGATAGTTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007769.1-1349s1c1
Sequence:CCGGCGTTCCTGATTATACACCAATCTCGAGATTGGTGTATAATCAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007769.1-3122s1c1
Sequence:CCGGCCCTTCAAACTATCCAAACAACTCGAGTTGTTTGGATAGTTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004406
DMBT1 MISSION shRNA Bacterial Glycerol Stock
deleted in malignant brain tumors 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004406.2-5539s21c1
Sequence:GTACCGGGTCATATTCCAACTCAGATTGCTCGAGCAATCTGAGTTGGAATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004406.2-5285s21c1
Sequence:CCGGTCCGTGTACCTGCGTTGTAAACTCGAGTTTACAACGCAGGTACACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004406.2-4782s21c1
Sequence:CCGGACAATGACACCATCGACTATTCTCGAGAATAGTCGATGGTGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004406.2-4721s21c1
Sequence:CCGGACGCCGAACCTGGTGATATTCCTCGAGGAATATCACCAGGTTCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004406.2-3866s21c1
Sequence:CCGGACCTTGAGGTTGGTCAATTTACTCGAGTAAATTGACCAACCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004406.1-4221s1c1
Sequence:CCGGCCCGTCCAAACACAGATTATTCTCGAGAATAATCTGTGTTTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004406.1-5157s1c1
Sequence:CCGGCGTCTTTGACTTATGATCTAACTCGAGTTAGATCATAAGTCAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004406.1-1553s1c1
Sequence:CCGGGCATCGACAGTAGGATCTGAACTCGAGTTCAGATCCTACTGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004406.1-3753s1c1
Sequence:CCGGCCAGGCAAATATTTACATCTTCTCGAGAAGATGTAAATATTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004406
DMBT1 MISSION shRNA shRNA Plasmid DNA
deleted in malignant brain tumors 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004406.2-5539s21c1
Sequence:GTACCGGGTCATATTCCAACTCAGATTGCTCGAGCAATCTGAGTTGGAATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004406.2-5285s21c1
Sequence:CCGGTCCGTGTACCTGCGTTGTAAACTCGAGTTTACAACGCAGGTACACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004406.2-4782s21c1
Sequence:CCGGACAATGACACCATCGACTATTCTCGAGAATAGTCGATGGTGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004406.2-4721s21c1
Sequence:CCGGACGCCGAACCTGGTGATATTCCTCGAGGAATATCACCAGGTTCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004406.2-3866s21c1
Sequence:CCGGACCTTGAGGTTGGTCAATTTACTCGAGTAAATTGACCAACCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004406.1-4221s1c1
Sequence:CCGGCCCGTCCAAACACAGATTATTCTCGAGAATAATCTGTGTTTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004406.1-5157s1c1
Sequence:CCGGCGTCTTTGACTTATGATCTAACTCGAGTTAGATCATAAGTCAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004406.1-1553s1c1
Sequence:CCGGGCATCGACAGTAGGATCTGAACTCGAGTTCAGATCCTACTGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004406.1-3753s1c1
Sequence:CCGGCCAGGCAAATATTTACATCTTCTCGAGAAGATGTAAATATTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004406
DMBT1 MISSION shRNA Lentiviral Transduction Particles
deleted in malignant brain tumors 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004406.2-5539s21c1
Sequence:GTACCGGGTCATATTCCAACTCAGATTGCTCGAGCAATCTGAGTTGGAATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004406.2-5285s21c1
Sequence:CCGGTCCGTGTACCTGCGTTGTAAACTCGAGTTTACAACGCAGGTACACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004406.2-4782s21c1
Sequence:CCGGACAATGACACCATCGACTATTCTCGAGAATAGTCGATGGTGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004406.2-4721s21c1
Sequence:CCGGACGCCGAACCTGGTGATATTCCTCGAGGAATATCACCAGGTTCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004406.2-3866s21c1
Sequence:CCGGACCTTGAGGTTGGTCAATTTACTCGAGTAAATTGACCAACCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004406.1-4221s1c1
Sequence:CCGGCCCGTCCAAACACAGATTATTCTCGAGAATAATCTGTGTTTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004406.1-5157s1c1
Sequence:CCGGCGTCTTTGACTTATGATCTAACTCGAGTTAGATCATAAGTCAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004406.1-1553s1c1
Sequence:CCGGGCATCGACAGTAGGATCTGAACTCGAGTTCAGATCCTACTGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004406.1-3753s1c1
Sequence:CCGGCCAGGCAAATATTTACATCTTCTCGAGAAGATGTAAATATTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks