EMAIL THIS PAGE TO A FRIEND

DMBX1

diencephalon/mesencephalon homeobox 1

73 Gene Product Result for
Synonyms: MBX OTX3 PAXB
UniProtKB ID: Q8NFW5, A6NNN2, Q8NFW6, Q8NHD9
Gene ID:
Human(127343) Summary: This gene encodes a member of the bicoid sub-family of homeodomain-containing transcription factors. The encoded protein acts as a transcription factor and may play a role in brain and sensory organ development. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(140477) diencephalon/mesencephalon homeobox 1
Rat(313512) diencephalon/mesencephalon homeobox 1
chicken(395271) diencephalon/mesencephalon homeobox 1
cow(540714) diencephalon/mesencephalon homeobox 1
domestic cat(101095758) diencephalon/mesencephalon homeobox 1
dog(610425) diencephalon/mesencephalon homeobox 1
sheep(101112369) diencephalon/mesencephalon homeobox 1
naked mole-rat(101722575) diencephalon/mesencephalon homeobox 1
domestic guinea pig(100731695) diencephalon/mesencephalon homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_147192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147192 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147192 Rosetta Predictions human pricing
NM_172225 Rosetta Predictions human pricing
NM_001107961 Rosetta Predictions rat pricing
NM_001025567 Rosetta Predictions mouse pricing
NM_130865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365534 predicted 1132
2 SASI_Hs01_00138474 predicted 855
3 SASI_Hs01_00138475 predicted 551
4 SASI_Hs01_00138477 predicted 1279
5 SASI_Hs01_00138478 predicted 1152
6 SASI_Hs01_00138479 predicted 553
7 SASI_Hs01_00138480 predicted 1203
8 SASI_Hs01_00138481 predicted 822
9 SASI_Hs01_00138482 predicted 836
10 SASI_Hs01_00138483 predicted 798
11 SASI_Hs01_00138476 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367935 predicted 1119
2 SASI_Hs01_00054862 predicted 839
3 SASI_Hs01_00054863 predicted 537
4 SASI_Hs01_00054865 predicted 1261
5 SASI_Hs01_00054866 predicted 1137
6 SASI_Hs01_00054867 predicted 541
7 SASI_Hs01_00054868 predicted 1186
8 SASI_Hs01_00054869 predicted 810
9 SASI_Hs01_00054870 predicted 817
10 SASI_Hs01_00054871 predicted 782
11 SASI_Hs01_00054864 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233995 predicted 2061
2 SASI_Rn02_00233996 predicted 2147
3 SASI_Rn02_00233997 predicted 3117
4 SASI_Rn02_00233998 predicted 2069
5 SASI_Rn02_00233999 predicted 1973
6 SASI_Rn02_00234000 predicted 2706
7 SASI_Rn02_00234001 predicted 2874
8 SASI_Rn02_00234002 predicted 2058
9 SASI_Rn02_00234003 predicted 2751
10 SASI_Rn02_00234004 predicted 2983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179391 predicted 539
2 SASI_Mm01_00179393 predicted 439
3 SASI_Mm01_00179394 predicted 76
4 SASI_Mm01_00179395 predicted 376
5 SASI_Mm01_00179397 predicted 975
6 SASI_Mm02_00287915 predicted 967
7 SASI_Mm01_00179398 predicted 378
8 SASI_Mm01_00179399 predicted 167
9 SASI_Mm01_00179400 predicted 809
10 SASI_Mm02_00287916 predicted 169
11 SASI_Mm01_00179392 predicted 844
12 SASI_Mm01_00179396 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108230 predicted 553
2 SASI_Mm01_00108232 predicted 448
3 SASI_Mm01_00108233 predicted 76
4 SASI_Mm01_00108234 predicted 391
5 SASI_Mm01_00108236 predicted 983
6 SASI_Mm02_00338286 predicted 396
7 SASI_Mm01_00108237 predicted 161
8 SASI_Mm01_00108238 predicted 823
9 SASI_Mm01_00108239 predicted 197
10 SASI_Mm02_00338287 predicted 169
11 SASI_Mm01_00108231 predicted 865
12 SASI_Mm01_00108235 predicted 1510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130865
DMBX1 MISSION shRNA Bacterial Glycerol Stock
diencephalon/mesencephalon homeobox 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130865.2-1255s1c1
Sequence:CCGGGCTCTCCAAGTTCTCCTAGAACTCGAGTTCTAGGAGAACTTGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130865.2-404s1c1
Sequence:CCGGCAGGGCCAAGTTCCGAAAGAACTCGAGTTCTTTCGGAACTTGGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130865.2-986s1c1
Sequence:CCGGCCAGTCCTATTACCAATCCCTCTCGAGAGGGATTGGTAATAGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130865.2-869s1c1
Sequence:CCGGCCTGATGCACTACTCGTCTTTCTCGAGAAAGACGAGTAGTGCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130865.2-351s1c1
Sequence:CCGGGCCATGTGTACCAATCTTCCTCTCGAGAGGAAGATTGGTACACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130865.3-1331s21c1
Sequence:CCGGTTTCACCTTGTCTCCCTTATTCTCGAGAATAAGGGAGACAAGGTGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130865.3-199s21c1
Sequence:CCGGCGCCTAGCTGGCTGTACATTTCTCGAGAAATGTACAGCCAGCTAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130865
DMBX1 MISSION shRNA shRNA Plasmid DNA
diencephalon/mesencephalon homeobox 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130865.2-1255s1c1
Sequence:CCGGGCTCTCCAAGTTCTCCTAGAACTCGAGTTCTAGGAGAACTTGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130865.2-404s1c1
Sequence:CCGGCAGGGCCAAGTTCCGAAAGAACTCGAGTTCTTTCGGAACTTGGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130865.2-986s1c1
Sequence:CCGGCCAGTCCTATTACCAATCCCTCTCGAGAGGGATTGGTAATAGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130865.2-869s1c1
Sequence:CCGGCCTGATGCACTACTCGTCTTTCTCGAGAAAGACGAGTAGTGCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130865.2-351s1c1
Sequence:CCGGGCCATGTGTACCAATCTTCCTCTCGAGAGGAAGATTGGTACACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130865.3-1331s21c1
Sequence:CCGGTTTCACCTTGTCTCCCTTATTCTCGAGAATAAGGGAGACAAGGTGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130865.3-199s21c1
Sequence:CCGGCGCCTAGCTGGCTGTACATTTCTCGAGAAATGTACAGCCAGCTAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130865
DMBX1 MISSION shRNA Lentiviral Transduction Particles
diencephalon/mesencephalon homeobox 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130865.2-1255s1c1
Sequence:CCGGGCTCTCCAAGTTCTCCTAGAACTCGAGTTCTAGGAGAACTTGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130865.2-404s1c1
Sequence:CCGGCAGGGCCAAGTTCCGAAAGAACTCGAGTTCTTTCGGAACTTGGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130865.2-986s1c1
Sequence:CCGGCCAGTCCTATTACCAATCCCTCTCGAGAGGGATTGGTAATAGGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130865.2-869s1c1
Sequence:CCGGCCTGATGCACTACTCGTCTTTCTCGAGAAAGACGAGTAGTGCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130865.2-351s1c1
Sequence:CCGGGCCATGTGTACCAATCTTCCTCTCGAGAGGAAGATTGGTACACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130865.3-1331s21c1
Sequence:CCGGTTTCACCTTGTCTCCCTTATTCTCGAGAATAAGGGAGACAAGGTGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130865.3-199s21c1
Sequence:CCGGCGCCTAGCTGGCTGTACATTTCTCGAGAAATGTACAGCCAGCTAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147192
DMBX1 MISSION shRNA Bacterial Glycerol Stock
diencephalon/mesencephalon homeobox 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147192.2-171s1c1
Sequence:CCGGCTGTACATTTCAAGACATCATCTCGAGATGATGTCTTGAAATGTACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147192.2-852s1c1
Sequence:CCGGCCTGGTGCACTACTCGTCCTTCTCGAGAAGGACGAGTAGTGCACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147192.2-1052s1c1
Sequence:CCGGGCCTGGCTCCTGCATCAGCTACTCGAGTAGCTGATGCAGGAGCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147192.2-133s21c1
Sequence:CCGGTCAGTGCATGCGCTTACATTGCTCGAGCAATGTAAGCGCATGCACTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147192.2-1443s21c1
Sequence:CCGGGCTAGATCCTCATCTCAATAGCTCGAGCTATTGAGATGAGGATCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147192
DMBX1 MISSION shRNA shRNA Plasmid DNA
diencephalon/mesencephalon homeobox 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147192.2-171s1c1
Sequence:CCGGCTGTACATTTCAAGACATCATCTCGAGATGATGTCTTGAAATGTACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147192.2-852s1c1
Sequence:CCGGCCTGGTGCACTACTCGTCCTTCTCGAGAAGGACGAGTAGTGCACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147192.2-1052s1c1
Sequence:CCGGGCCTGGCTCCTGCATCAGCTACTCGAGTAGCTGATGCAGGAGCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147192.2-133s21c1
Sequence:CCGGTCAGTGCATGCGCTTACATTGCTCGAGCAATGTAAGCGCATGCACTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147192.2-1443s21c1
Sequence:CCGGGCTAGATCCTCATCTCAATAGCTCGAGCTATTGAGATGAGGATCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147192
DMBX1 MISSION shRNA Lentiviral Transduction Particles
diencephalon/mesencephalon homeobox 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147192.2-171s1c1
Sequence:CCGGCTGTACATTTCAAGACATCATCTCGAGATGATGTCTTGAAATGTACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147192.2-852s1c1
Sequence:CCGGCCTGGTGCACTACTCGTCCTTCTCGAGAAGGACGAGTAGTGCACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147192.2-1052s1c1
Sequence:CCGGGCCTGGCTCCTGCATCAGCTACTCGAGTAGCTGATGCAGGAGCCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147192.2-133s21c1
Sequence:CCGGTCAGTGCATGCGCTTACATTGCTCGAGCAATGTAAGCGCATGCACTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147192.2-1443s21c1
Sequence:CCGGGCTAGATCCTCATCTCAATAGCTCGAGCTATTGAGATGAGGATCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)