EMAIL THIS PAGE TO A FRIEND

DMC1

DNA meiotic recombinase 1

47 Gene Product Result for
Synonyms: DMC1H LIM15 dJ199H16.1
UniProtKB ID: Q14565, A8K9A2, Q08AI1, Q99498, Q9UH11
Gene ID:
Human(11144) Summary: This gene encodes a member of the superfamily of recombinases (also called DNA strand-exchange proteins). Recombinases are important for repairing double-strand DNA breaks during mitosis and meiosis. This protein, which is evolutionarily conserved, is reported to be essential for meiotic homologous recombination and may thus play an important role in generating diversity of genetic information. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(13404) DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination
Rat(362960) DNA meiotic recombinase 1
sheep(101104983) DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)
domestic guinea pig(100728806) DNA meiotic recombinase 1
naked mole-rat(101705756) DNA meiotic recombinase 1
Zebrafish(553953) DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)
chicken(427903) DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)
dog(608268) DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)
Horse(100055204) DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)
cow(618398) DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)
domestic cat(101080899) DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)
Thale Cress(821860) meiotic recombination protein DMC1-like protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007068 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010059 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010059 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010059 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118621 MISSION® esiRNA esiRNA human DMC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007068 Rosetta Predictions human pricing
NM_001130567 Rosetta Predictions rat pricing
NM_010059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137021 predicted 1039
2 SASI_Hs01_00137022 predicted 825
3 SASI_Hs01_00137023 predicted 733
4 SASI_Hs01_00137025 predicted 372
5 SASI_Hs01_00137026 predicted 510
6 SASI_Hs02_00342892 predicted 730
7 SASI_Hs01_00137027 predicted 434
8 SASI_Hs01_00137029 predicted 499
9 SASI_Hs01_00137030 predicted 681
10 SASI_Hs02_00342893 predicted 245
11 SASI_Hs01_00137024 predicted 325
12 SASI_Hs01_00137028 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255839 predicted 1015
2 SASI_Rn02_00255840 predicted 826
3 SASI_Rn02_00255841 predicted 902
4 SASI_Rn02_00255842 predicted 1488
5 SASI_Rn02_00255843 predicted 1435
6 SASI_Rn02_00255844 predicted 881
7 SASI_Rn02_00255845 predicted 1015
8 SASI_Rn02_00255846 predicted 1124
9 SASI_Rn02_00255847 predicted 1130
10 SASI_Rn02_00255848 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030309 predicted 804
2 SASI_Mm01_00030310 predicted 1241
3 SASI_Mm01_00030311 predicted 430
4 SASI_Mm01_00030312 predicted 495
5 SASI_Mm02_00317717 predicted 406
6 SASI_Mm01_00030313 predicted 713
7 SASI_Mm01_00030314 predicted 1024
8 SASI_Mm01_00030316 predicted 715
9 SASI_Mm01_00030317 predicted 396
10 SASI_Mm01_00030318 predicted 382
11 SASI_Mm01_00030315 predicted 322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007068
VALIDATED
DMC1 MISSION shRNA Bacterial Glycerol Stock
DNA meiotic recombinase 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007068.2-1524s21c1
Sequence:CCGGTGGGAAAGGAGTACGTGATTCCTCGAGGAATCACGTACTCCTTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007068.2-377s21c1
Sequence:CCGGGCCAAAGTAGACAAGATTAAACTCGAGTTTAATCTTGTCTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007068.2-269s21c1
Sequence:CCGGATTAACGTGGCTGACATTAAGCTCGAGCTTAATGTCAGCCACGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007068.2-1356s21c1
Sequence:CCGGCCCTGATTTATGATAACTATACTCGAGTATAGTTATCATAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007068.2-725s21c1
Sequence:CCGGGTACTGGACAACGTACTTTATCTCGAGATAAAGTACGTTGTCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007068.2-689s21c1
Sequence:CCGGGACATTGCTGATCGCTTTAATCTCGAGATTAAAGCGATCAGCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007068.2-814s21c1
Sequence:CCGGAGCTGGCATCTTCAAGCTATTCTCGAGAATAGCTTGAAGATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007068.2-429s21c1
Sequence:CCGGTCTTGACTGCATTTGAGTATACTCGAGTATACTCAAATGCAGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007068.2-1159s1c1
Sequence:CCGGCGCAATAACTGCTGGAGGAATCTCGAGATTCCTCCAGCAGTTATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007068.2-722s1c1
Sequence:CCGGGCAGTACTGGACAACGTACTTCTCGAGAAGTACGTTGTCCAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007068.2-2000s1c1
Sequence:CCGGGCAGTGGCATGTGCTTGTAATCTCGAGATTACAAGCACATGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007068.2-484s1c1
Sequence:CCGGCGGGAGCCAGGAATTTGATAACTCGAGTTATCAAATTCCTGGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007068.2-736s1c1
Sequence:CCGGCGTACTTTATGCACGTGCATACTCGAGTATGCACGTGCATAAAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007068.2-401s1c1
Sequence:CCGGGCAGCGAACAAACTAATTGAACTCGAGTTCAATTAGTTTGTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007068.2-1212s1c1
Sequence:CCGGGCAAATTGCTTCTTAGTGCTTCTCGAGAAGCACTAAGAAGCAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007068.2-1056s1c1
Sequence:CCGGCTCATGCTTCAACAACAAGAACTCGAGTTCTTGTTGTTGAAGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007068
VALIDATED
DMC1 MISSION shRNA shRNA Plasmid DNA
DNA meiotic recombinase 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007068.2-1524s21c1
Sequence:CCGGTGGGAAAGGAGTACGTGATTCCTCGAGGAATCACGTACTCCTTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007068.2-377s21c1
Sequence:CCGGGCCAAAGTAGACAAGATTAAACTCGAGTTTAATCTTGTCTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007068.2-269s21c1
Sequence:CCGGATTAACGTGGCTGACATTAAGCTCGAGCTTAATGTCAGCCACGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007068.2-1356s21c1
Sequence:CCGGCCCTGATTTATGATAACTATACTCGAGTATAGTTATCATAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007068.2-725s21c1
Sequence:CCGGGTACTGGACAACGTACTTTATCTCGAGATAAAGTACGTTGTCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007068.2-689s21c1
Sequence:CCGGGACATTGCTGATCGCTTTAATCTCGAGATTAAAGCGATCAGCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007068.2-814s21c1
Sequence:CCGGAGCTGGCATCTTCAAGCTATTCTCGAGAATAGCTTGAAGATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007068.2-429s21c1
Sequence:CCGGTCTTGACTGCATTTGAGTATACTCGAGTATACTCAAATGCAGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007068.2-1159s1c1
Sequence:CCGGCGCAATAACTGCTGGAGGAATCTCGAGATTCCTCCAGCAGTTATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007068.2-722s1c1
Sequence:CCGGGCAGTACTGGACAACGTACTTCTCGAGAAGTACGTTGTCCAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007068.2-2000s1c1
Sequence:CCGGGCAGTGGCATGTGCTTGTAATCTCGAGATTACAAGCACATGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007068.2-484s1c1
Sequence:CCGGCGGGAGCCAGGAATTTGATAACTCGAGTTATCAAATTCCTGGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007068.2-736s1c1
Sequence:CCGGCGTACTTTATGCACGTGCATACTCGAGTATGCACGTGCATAAAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007068.2-401s1c1
Sequence:CCGGGCAGCGAACAAACTAATTGAACTCGAGTTCAATTAGTTTGTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007068.2-1212s1c1
Sequence:CCGGGCAAATTGCTTCTTAGTGCTTCTCGAGAAGCACTAAGAAGCAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007068.2-1056s1c1
Sequence:CCGGCTCATGCTTCAACAACAAGAACTCGAGTTCTTGTTGTTGAAGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007068
VALIDATED
DMC1 MISSION shRNA Lentiviral Transduction Particles
DNA meiotic recombinase 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007068.2-1524s21c1
Sequence:CCGGTGGGAAAGGAGTACGTGATTCCTCGAGGAATCACGTACTCCTTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007068.2-377s21c1
Sequence:CCGGGCCAAAGTAGACAAGATTAAACTCGAGTTTAATCTTGTCTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007068.2-269s21c1
Sequence:CCGGATTAACGTGGCTGACATTAAGCTCGAGCTTAATGTCAGCCACGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007068.2-1356s21c1
Sequence:CCGGCCCTGATTTATGATAACTATACTCGAGTATAGTTATCATAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007068.2-725s21c1
Sequence:CCGGGTACTGGACAACGTACTTTATCTCGAGATAAAGTACGTTGTCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007068.2-689s21c1
Sequence:CCGGGACATTGCTGATCGCTTTAATCTCGAGATTAAAGCGATCAGCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007068.2-814s21c1
Sequence:CCGGAGCTGGCATCTTCAAGCTATTCTCGAGAATAGCTTGAAGATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007068.2-429s21c1
Sequence:CCGGTCTTGACTGCATTTGAGTATACTCGAGTATACTCAAATGCAGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007068.2-1159s1c1
Sequence:CCGGCGCAATAACTGCTGGAGGAATCTCGAGATTCCTCCAGCAGTTATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007068.2-722s1c1
Sequence:CCGGGCAGTACTGGACAACGTACTTCTCGAGAAGTACGTTGTCCAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007068.2-2000s1c1
Sequence:CCGGGCAGTGGCATGTGCTTGTAATCTCGAGATTACAAGCACATGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007068.2-484s1c1
Sequence:CCGGCGGGAGCCAGGAATTTGATAACTCGAGTTATCAAATTCCTGGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007068.2-736s1c1
Sequence:CCGGCGTACTTTATGCACGTGCATACTCGAGTATGCACGTGCATAAAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007068.2-401s1c1
Sequence:CCGGGCAGCGAACAAACTAATTGAACTCGAGTTCAATTAGTTTGTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007068.2-1212s1c1
Sequence:CCGGGCAAATTGCTTCTTAGTGCTTCTCGAGAAGCACTAAGAAGCAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007068.2-1056s1c1
Sequence:CCGGCTCATGCTTCAACAACAAGAACTCGAGTTCTTGTTGTTGAAGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010059
DMC1 MISSION shRNA Bacterial Glycerol Stock
DNA meiotic recombinase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215330    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010059.2-1348s1c1
Sequence:CCGGCTGATATGCAACCAACTATATCTCGAGATATAGTTGGTTGCATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010059.2-970s21c1
Sequence:CCGGGCAGATCCAGGAGCAACTATGCTCGAGCATAGTTGCTCCTGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010059.2-1349s21c1
Sequence:CCGGTGATATGCAACCAACTATATACTCGAGTATATAGTTGGTTGCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010059.2-283s21c1
Sequence:CCGGGTAGGAATCTGTACCATTAAACTCGAGTTTAATGGTACAGATTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010059.2-1127s21c1
Sequence:CCGGATGAAGCCACCTTCGCAATAACTCGAGTTATTGCGAAGGTGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010059.2-707s21c1
Sequence:CCGGTACTGGACAACGTGCTCTATGCTCGAGCATAGAGCACGTTGTCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010059.1-496s1c1
Sequence:CCGGGTGGCATTGAAAGTATGGCAACTCGAGTTGCCATACTTTCAATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010059.1-183s1c1
Sequence:CCGGGAATCGGGATTCCAAGATGATCTCGAGATCATCTTGGAATCCCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010059
DMC1 MISSION shRNA shRNA Plasmid DNA
DNA meiotic recombinase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215330    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010059.2-1348s1c1
Sequence:CCGGCTGATATGCAACCAACTATATCTCGAGATATAGTTGGTTGCATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010059.2-970s21c1
Sequence:CCGGGCAGATCCAGGAGCAACTATGCTCGAGCATAGTTGCTCCTGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010059.2-1349s21c1
Sequence:CCGGTGATATGCAACCAACTATATACTCGAGTATATAGTTGGTTGCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010059.2-283s21c1
Sequence:CCGGGTAGGAATCTGTACCATTAAACTCGAGTTTAATGGTACAGATTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010059.2-1127s21c1
Sequence:CCGGATGAAGCCACCTTCGCAATAACTCGAGTTATTGCGAAGGTGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010059.2-707s21c1
Sequence:CCGGTACTGGACAACGTGCTCTATGCTCGAGCATAGAGCACGTTGTCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010059.1-496s1c1
Sequence:CCGGGTGGCATTGAAAGTATGGCAACTCGAGTTGCCATACTTTCAATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010059.1-183s1c1
Sequence:CCGGGAATCGGGATTCCAAGATGATCTCGAGATCATCTTGGAATCCCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010059
DMC1 MISSION shRNA Lentiviral Transduction Particles
DNA meiotic recombinase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215330    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010059.2-1348s1c1
Sequence:CCGGCTGATATGCAACCAACTATATCTCGAGATATAGTTGGTTGCATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010059.2-970s21c1
Sequence:CCGGGCAGATCCAGGAGCAACTATGCTCGAGCATAGTTGCTCCTGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010059.2-1349s21c1
Sequence:CCGGTGATATGCAACCAACTATATACTCGAGTATATAGTTGGTTGCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010059.2-283s21c1
Sequence:CCGGGTAGGAATCTGTACCATTAAACTCGAGTTTAATGGTACAGATTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010059.2-1127s21c1
Sequence:CCGGATGAAGCCACCTTCGCAATAACTCGAGTTATTGCGAAGGTGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010059.2-707s21c1
Sequence:CCGGTACTGGACAACGTGCTCTATGCTCGAGCATAGAGCACGTTGTCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010059.1-496s1c1
Sequence:CCGGGTGGCATTGAAAGTATGGCAACTCGAGTTGCCATACTTTCAATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010059.1-183s1c1
Sequence:CCGGGAATCGGGATTCCAAGATGATCTCGAGATCATCTTGGAATCCCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks