EMAIL THIS PAGE TO A FRIEND

DMD

dystrophin

Synonyms: BMD CMD3B DXS142 DXS164 DXS206 DXS230 DXS239 DXS268 DXS269 DXS270 DXS272
Gene ID:
Human(1756) Summary: The dystrophin gene is the largest gene found in nature, measuring 2.4 Mb. The gene was identified through a positional cloning approach, targeted at the isolation of the gene responsible for Duchenne (DMD) and Becker (BMD) Muscular Dystrophies. DMD is a recessive, fatal, X-linked disorder occurring at a frequency of about 1 in 3,500 new-born males. BMD is a milder allelic form. In general, DMD patients carry mutations which cause premature translation termination (nonsense or frame shift mutations), while in BMD patients dystrophin is reduced either in molecular weight (derived from in-frame deletions) or in expression level. The dystrophin gene is highly complex, containing at least eight independent, tissue-specific promoters and two polyA-addition sites. Furthermore, dystrophin RNA is differentially spliced, producing a range of different transcripts, encoding a large set of protein isoforms. Dystrophin (as encoded by the Dp427 transcripts) is a large, rod-like cytoskeletal protein which is found at the inner surface of muscle fibers. Dystrophin is part of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton (F-actin) and the extra-cellular matrix. [provided by RefSeq, Jul 2008]
Mouse(13405) dystrophin, muscular dystrophy
Rat(24907) dystrophin
Zebrafish(83773) dystrophin
cow(540755) dystrophin
chicken(396236) dystrophin
dog(606758) dystrophin
Horse(100051515) dystrophin
domestic cat(100750243) Duchenne muscular dystrophy
sheep(101119444) dystrophin
Gene Class: Calcium_Binding
413 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004017 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000109 Rosetta Predictions human pricing
NM_004006 Rosetta Predictions human pricing
NM_004007 Rosetta Predictions human pricing
NM_004009 Rosetta Predictions human pricing
NM_004010 Rosetta Predictions human pricing
NM_004011 Rosetta Predictions human pricing
NM_004012 Rosetta Predictions human pricing
NM_004013 Rosetta Predictions human pricing
NM_004014 Rosetta Predictions human pricing
NM_004015 Rosetta Predictions human pricing
NM_004016 Rosetta Predictions human pricing
NM_004017 Rosetta Predictions human pricing
NM_004018 Rosetta Predictions human pricing
NM_004019 Rosetta Predictions human pricing
NM_004020 Rosetta Predictions human pricing
NM_004021 Rosetta Predictions human pricing
NM_004022 Rosetta Predictions human pricing
NM_004023 Rosetta Predictions human pricing
NM_001005244 Rosetta Predictions rat pricing
NM_001005246 Rosetta Predictions rat pricing
NM_012698 Rosetta Predictions rat pricing
NM_007868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054006 predicted 10270
2 SASI_Hs01_00054007 predicted 9858
3 SASI_Hs01_00054008 predicted 9932
4 SASI_Hs01_00054009 predicted 9848
5 SASI_Hs01_00054010 predicted 9895
6 SASI_Hs01_00054011 predicted 10284
7 SASI_Hs01_00054012 predicted 10228
8 SASI_Hs01_00054014 predicted 10057
9 SASI_Hs02_00301886 predicted 10031
10 SASI_Hs02_00301887 predicted 10024
11 SASI_Hs01_00054005 predicted 9953
12 SASI_Hs01_00054013 predicted 10256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027020 predicted 10196
2 SASI_Hs01_00027021 predicted 9786
3 SASI_Hs01_00027022 predicted 9852
4 SASI_Hs01_00027023 predicted 9772
5 SASI_Hs01_00027024 predicted 9819
6 SASI_Hs01_00027025 predicted 10214
7 SASI_Hs01_00027026 predicted 10157
8 SASI_Hs01_00027028 predicted 9987
9 SASI_Hs02_00336739 predicted 9957
10 SASI_Hs02_00336740 predicted 9951
11 SASI_Hs01_00027019 predicted 9885
12 SASI_Hs01_00027027 predicted 10175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032180 predicted 9968
2 SASI_Hs01_00032181 predicted 9557
3 SASI_Hs01_00032182 predicted 9627
4 SASI_Hs01_00032183 predicted 9544
5 SASI_Hs01_00032184 predicted 9590
6 SASI_Hs01_00032185 predicted 9979
7 SASI_Hs01_00032186 predicted 9928
8 SASI_Hs01_00032188 predicted 9753
9 SASI_Hs02_00336741 predicted 9719
10 SASI_Hs02_00336742 predicted 9726
11 SASI_Hs01_00032179 predicted 9654
12 SASI_Hs01_00032187 predicted 9949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103288 predicted 10202
2 SASI_Hs01_00103289 predicted 9785
3 SASI_Hs01_00103290 predicted 9859
4 SASI_Hs01_00103291 predicted 9780
5 SASI_Hs01_00103292 predicted 9817
6 SASI_Hs01_00103293 predicted 10221
7 SASI_Hs01_00103294 predicted 10162
8 SASI_Hs01_00103296 predicted 9991
9 SASI_Hs02_00336743 predicted 9957
10 SASI_Hs02_00336744 predicted 9958
11 SASI_Hs01_00103287 predicted 9884
12 SASI_Hs01_00103295 predicted 10184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228753 predicted 10288
2 SASI_Hs01_00228754 predicted 9872
3 SASI_Hs01_00228755 predicted 9946
4 SASI_Hs01_00228756 predicted 9864
5 SASI_Hs01_00228757 predicted 9907
6 SASI_Hs01_00228758 predicted 10307
7 SASI_Hs01_00228759 predicted 10241
8 SASI_Hs01_00228761 predicted 10070
9 SASI_Hs02_00336745 predicted 10038
10 SASI_Hs02_00336746 predicted 10042
11 SASI_Hs01_00228752 predicted 9967
12 SASI_Hs01_00228760 predicted 10270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199665 predicted 5976
2 SASI_Hs01_00199666 predicted 5560
3 SASI_Hs01_00199667 predicted 5637
4 SASI_Hs01_00199668 predicted 5554
5 SASI_Hs01_00199669 predicted 5597
6 SASI_Hs01_00199670 predicted 5990
7 SASI_Hs01_00199671 predicted 5935
8 SASI_Hs01_00199673 predicted 5764
9 SASI_Hs02_00336747 predicted 5728
10 SASI_Hs02_00336748 predicted 5728
11 SASI_Hs01_00199664 predicted 5657
12 SASI_Hs01_00199672 predicted 5952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156658 predicted 6122
2 SASI_Hs01_00156659 predicted 5707
3 SASI_Hs01_00156660 predicted 5775
4 SASI_Hs01_00156661 predicted 5698
5 SASI_Hs01_00156662 predicted 5736
6 SASI_Hs01_00156663 predicted 6132
7 SASI_Hs01_00156664 predicted 6072
8 SASI_Hs01_00156666 predicted 5900
9 SASI_Hs02_00336749 predicted 5878
10 SASI_Hs02_00336750 predicted 5870
11 SASI_Hs01_00156657 predicted 5801
12 SASI_Hs01_00156665 predicted 6101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139125 predicted 3611
2 SASI_Hs01_00139126 predicted 3200
3 SASI_Hs01_00139127 predicted 3273
4 SASI_Hs01_00139128 predicted 3192
5 SASI_Hs01_00139129 predicted 3236
6 SASI_Hs01_00139130 predicted 3626
7 SASI_Hs01_00139131 predicted 3576
8 SASI_Hs01_00139133 predicted 3403
9 SASI_Hs02_00336751 predicted 3371
10 SASI_Hs02_00336752 predicted 3366
11 SASI_Hs01_00139124 predicted 3300
12 SASI_Hs01_00139132 predicted 3595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074284 predicted 1827
2 SASI_Hs01_00074285 predicted 1413
3 SASI_Hs01_00074286 predicted 1485
4 SASI_Hs01_00074287 predicted 1407
5 SASI_Hs01_00074288 predicted 1444
6 SASI_Hs01_00074289 predicted 1842
7 SASI_Hs01_00074290 predicted 1786
8 SASI_Hs01_00074292 predicted 1612
9 SASI_Hs02_00336753 predicted 1587
10 SASI_Hs02_00336754 predicted 1585
11 SASI_Hs01_00074283 predicted 1508
12 SASI_Hs01_00074291 predicted 1807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170700 predicted 826
2 SASI_Hs01_00170701 predicted 417
3 SASI_Hs01_00170702 predicted 487
4 SASI_Hs01_00170703 predicted 406
5 SASI_Hs01_00170704 predicted 445
6 SASI_Hs01_00170705 predicted 843
7 SASI_Hs01_00170706 predicted 785
8 SASI_Hs01_00170708 predicted 616
9 SASI_Hs02_00336755 predicted 579
10 SASI_Hs02_00336756 predicted 578
11 SASI_Hs01_00170699 predicted 516
12 SASI_Hs01_00170707 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151980 predicted 829
2 SASI_Hs01_00151981 predicted 411
3 SASI_Hs01_00151982 predicted 489
4 SASI_Hs01_00151983 predicted 406
5 SASI_Hs01_00151984 predicted 445
6 SASI_Hs01_00151985 predicted 845
7 SASI_Hs01_00151986 predicted 789
8 SASI_Hs01_00151988 predicted 611
9 SASI_Hs02_00336757 predicted 581
10 SASI_Hs02_00336758 predicted 583
11 SASI_Hs01_00151979 predicted 506
12 SASI_Hs01_00151987 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237540 predicted 827
2 SASI_Hs01_00237541 predicted 415
3 SASI_Hs01_00237542 predicted 488
4 SASI_Hs01_00237543 predicted 409
5 SASI_Hs01_00237544 predicted 443
6 SASI_Hs01_00237545 predicted 839
7 SASI_Hs01_00237546 predicted 786
8 SASI_Hs01_00237548 predicted 617
9 SASI_Hs02_00336759 predicted 579
10 SASI_Hs02_00336760 predicted 581
11 SASI_Hs01_00237539 predicted 515
12 SASI_Hs01_00237547 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048041 predicted 822
2 SASI_Hs01_00048042 predicted 408
3 SASI_Hs01_00048043 predicted 487
4 SASI_Hs01_00048044 predicted 406
5 SASI_Hs01_00048045 predicted 448
6 SASI_Hs01_00048046 predicted 845
7 SASI_Hs01_00048047 predicted 787
8 SASI_Hs01_00048049 predicted 615
9 SASI_Hs02_00336761 predicted 580
10 SASI_Hs02_00336762 predicted 582
11 SASI_Hs01_00048040 predicted 508
12 SASI_Hs01_00048048 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244935 predicted 822
2 SASI_Hs01_00244936 predicted 413
3 SASI_Hs01_00244937 predicted 488
4 SASI_Hs01_00244938 predicted 404
5 SASI_Hs01_00244939 predicted 445
6 SASI_Hs01_00244940 predicted 844
7 SASI_Hs01_00244941 predicted 781
8 SASI_Hs01_00244943 predicted 609
9 SASI_Hs02_00336763 predicted 580
10 SASI_Hs02_00336764 predicted 580
11 SASI_Hs01_00244934 predicted 513
12 SASI_Hs01_00244942 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092388 predicted 3611
2 SASI_Hs01_00092389 predicted 3204
3 SASI_Hs01_00092390 predicted 3270
4 SASI_Hs01_00092391 predicted 3195
5 SASI_Hs01_00092392 predicted 3227
6 SASI_Hs01_00092393 predicted 3631
7 SASI_Hs01_00092394 predicted 3576
8 SASI_Hs01_00092396 predicted 3397
9 SASI_Hs02_00336765 predicted 3372
10 SASI_Hs02_00336766 predicted 3370
11 SASI_Hs01_00092387 predicted 3296
12 SASI_Hs01_00092395 predicted 3590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202985 predicted 3614
2 SASI_Hs01_00202986 predicted 3204
3 SASI_Hs01_00202987 predicted 3278
4 SASI_Hs01_00202988 predicted 3195
5 SASI_Hs01_00202989 predicted 3235
6 SASI_Hs01_00202990 predicted 3630
7 SASI_Hs01_00202991 predicted 3577
8 SASI_Hs01_00202993 predicted 3398
9 SASI_Hs02_00336767 predicted 3374
10 SASI_Hs02_00336768 predicted 3366
11 SASI_Hs01_00202984 predicted 3299
12 SASI_Hs01_00202992 predicted 3588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138875 predicted 3618
2 SASI_Hs01_00138876 predicted 3202
3 SASI_Hs01_00138877 predicted 3277
4 SASI_Hs01_00138878 predicted 3195
5 SASI_Hs01_00138879 predicted 3235
6 SASI_Hs01_00138880 predicted 3629
7 SASI_Hs01_00138881 predicted 3574
8 SASI_Hs01_00138883 predicted 3399
9 SASI_Hs02_00336769 predicted 3365
10 SASI_Hs02_00336770 predicted 3367
11 SASI_Hs01_00138874 predicted 3296
12 SASI_Hs01_00138882 predicted 3595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018946 predicted 3613
2 SASI_Hs01_00018947 predicted 3200
3 SASI_Hs01_00018948 predicted 3277
4 SASI_Hs01_00018949 predicted 3192
5 SASI_Hs01_00018950 predicted 3234
6 SASI_Hs01_00018951 predicted 3634
7 SASI_Hs01_00018952 predicted 3570
8 SASI_Hs01_00018954 predicted 3403
9 SASI_Hs02_00336771 predicted 3372
10 SASI_Hs02_00336772 predicted 3367
11 SASI_Hs01_00018945 predicted 3297
12 SASI_Hs01_00018953 predicted 3597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055108 predicted 317
2 SASI_Rn01_00055109 predicted 860
3 SASI_Rn01_00055110 predicted 522
4 SASI_Rn01_00055111 predicted 840
5 SASI_Rn01_00055112 predicted 680
6 SASI_Rn01_00055113 predicted 823
7 SASI_Rn01_00055114 predicted 329
8 SASI_Rn01_00055115 predicted 342
9 SASI_Rn01_00055116 predicted 694
10 SASI_Rn01_00055117 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066297 predicted 315
2 SASI_Rn01_00066298 predicted 865
3 SASI_Rn01_00066299 predicted 519
4 SASI_Rn01_00066300 predicted 842
5 SASI_Rn01_00066301 predicted 680
6 SASI_Rn01_00066302 predicted 819
7 SASI_Rn01_00066303 predicted 329
8 SASI_Rn01_00066304 predicted 339
9 SASI_Rn01_00066305 predicted 695
10 SASI_Rn01_00066306 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087589 predicted 321
2 SASI_Rn01_00087590 predicted 866
3 SASI_Rn01_00087591 predicted 519
4 SASI_Rn01_00087592 predicted 838
5 SASI_Rn01_00087593 predicted 683
6 SASI_Rn01_00087594 predicted 824
7 SASI_Rn01_00087595 predicted 325
8 SASI_Rn01_00087596 predicted 341
9 SASI_Rn01_00087597 predicted 687
10 SASI_Rn01_00087598 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312654 predicted 4080
2 SASI_Mm01_00155233 predicted 2488
3 SASI_Mm01_00155234 predicted 6379
4 SASI_Mm01_00155235 predicted 3851
5 SASI_Mm01_00155236 predicted 2191
6 SASI_Mm01_00155237 predicted 1120
7 SASI_Mm01_00155238 predicted 6655
8 SASI_Mm01_00155239 predicted 10599
9 SASI_Mm01_00155240 predicted 965
10 SASI_Mm01_00155241 predicted 6540
11 SASI_Mm01_00155242 predicted 668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007868
DMD MISSION shRNA Bacterial Glycerol Stock
dystrophin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007868.1-11886s1c1
Sequence:CCGGCCACCAAATGACTGCTTCATACTCGAGTATGAAGCAGTCATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007868.1-10007s1c1
Sequence:CCGGGCCAATAATAAACCTGAGATTCTCGAGAATCTCAGGTTTATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007868.1-753s1c1
Sequence:CCGGCCGACCTGTTTGATTGGAATACTCGAGTATTCCAATCAAACAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007868.1-1236s1c1
Sequence:CCGGCGGAAGTAAATCTGGATAGTTCTCGAGAACTATCCAGATTTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007868.1-6094s1c1
Sequence:CCGGGCGGCAAATTGAGAGCAATTTCTCGAGAAATTGCTCTCAATTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007868
DMD MISSION shRNA shRNA Plasmid DNA
dystrophin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007868.1-11886s1c1
Sequence:CCGGCCACCAAATGACTGCTTCATACTCGAGTATGAAGCAGTCATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007868.1-10007s1c1
Sequence:CCGGGCCAATAATAAACCTGAGATTCTCGAGAATCTCAGGTTTATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007868.1-753s1c1
Sequence:CCGGCCGACCTGTTTGATTGGAATACTCGAGTATTCCAATCAAACAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007868.1-1236s1c1
Sequence:CCGGCGGAAGTAAATCTGGATAGTTCTCGAGAACTATCCAGATTTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007868.1-6094s1c1
Sequence:CCGGGCGGCAAATTGAGAGCAATTTCTCGAGAAATTGCTCTCAATTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007868
DMD MISSION shRNA Lentiviral Transduction Particles
dystrophin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007868.1-11886s1c1
Sequence:CCGGCCACCAAATGACTGCTTCATACTCGAGTATGAAGCAGTCATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007868.1-10007s1c1
Sequence:CCGGGCCAATAATAAACCTGAGATTCTCGAGAATCTCAGGTTTATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007868.1-753s1c1
Sequence:CCGGCCGACCTGTTTGATTGGAATACTCGAGTATTCCAATCAAACAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007868.1-1236s1c1
Sequence:CCGGCGGAAGTAAATCTGGATAGTTCTCGAGAACTATCCAGATTTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007868.1-6094s1c1
Sequence:CCGGGCGGCAAATTGAGAGCAATTTCTCGAGAAATTGCTCTCAATTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004017
DMD MISSION shRNA Bacterial Glycerol Stock
dystrophin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-1836s1c1
Sequence:CCGGCCCTAGTTCAAGAGGAAGAAACTCGAGTTTCTTCCTCTTGAACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-668s1c1
Sequence:CCGGGCTGCTTCCAATTTGCTAATACTCGAGTATTAGCAAATTGGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-150s1c1
Sequence:CCGGCCAGTCTTTAGCTGACCTGAACTCGAGTTCAGGTCAGCTAAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-1251s1c1
Sequence:CCGGCCAGCATTACTGCCAAAGTTTCTCGAGAAACTTTGGCAGTAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-805s1c1
Sequence:CCGGGCCAAATGTAACATCTGCAAACTCGAGTTTGCAGATGTTACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004017.2-1398s21c1
Sequence:CCGGAGCAGAATATGACCGTCTAAACTCGAGTTTAGACGGTCATATTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004017.2-984s21c1
Sequence:CCGGAGACTTTGCCAAGGTACTAAACTCGAGTTTAGTACCTTGGCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004017.2-932s21c1
Sequence:CCGGACTATCCCATGGTGGAATATTCTCGAGAATATTCCACCATGGGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004017.2-2077s21c1
Sequence:CCGGTGTGAAGGGTAGTGGTATTATCTCGAGATAATACCACTACCCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004017
DMD MISSION shRNA shRNA Plasmid DNA
dystrophin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-1836s1c1
Sequence:CCGGCCCTAGTTCAAGAGGAAGAAACTCGAGTTTCTTCCTCTTGAACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-668s1c1
Sequence:CCGGGCTGCTTCCAATTTGCTAATACTCGAGTATTAGCAAATTGGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-150s1c1
Sequence:CCGGCCAGTCTTTAGCTGACCTGAACTCGAGTTCAGGTCAGCTAAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-1251s1c1
Sequence:CCGGCCAGCATTACTGCCAAAGTTTCTCGAGAAACTTTGGCAGTAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-805s1c1
Sequence:CCGGGCCAAATGTAACATCTGCAAACTCGAGTTTGCAGATGTTACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004017.2-1398s21c1
Sequence:CCGGAGCAGAATATGACCGTCTAAACTCGAGTTTAGACGGTCATATTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004017.2-984s21c1
Sequence:CCGGAGACTTTGCCAAGGTACTAAACTCGAGTTTAGTACCTTGGCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004017.2-932s21c1
Sequence:CCGGACTATCCCATGGTGGAATATTCTCGAGAATATTCCACCATGGGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004017.2-2077s21c1
Sequence:CCGGTGTGAAGGGTAGTGGTATTATCTCGAGATAATACCACTACCCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004017
DMD MISSION shRNA Lentiviral Transduction Particles
dystrophin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-1836s1c1
Sequence:CCGGCCCTAGTTCAAGAGGAAGAAACTCGAGTTTCTTCCTCTTGAACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-668s1c1
Sequence:CCGGGCTGCTTCCAATTTGCTAATACTCGAGTATTAGCAAATTGGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-150s1c1
Sequence:CCGGCCAGTCTTTAGCTGACCTGAACTCGAGTTCAGGTCAGCTAAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-1251s1c1
Sequence:CCGGCCAGCATTACTGCCAAAGTTTCTCGAGAAACTTTGGCAGTAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004017.1-805s1c1
Sequence:CCGGGCCAAATGTAACATCTGCAAACTCGAGTTTGCAGATGTTACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004017.2-1398s21c1
Sequence:CCGGAGCAGAATATGACCGTCTAAACTCGAGTTTAGACGGTCATATTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004017.2-984s21c1
Sequence:CCGGAGACTTTGCCAAGGTACTAAACTCGAGTTTAGTACCTTGGCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004017.2-932s21c1
Sequence:CCGGACTATCCCATGGTGGAATATTCTCGAGAATATTCCACCATGGGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004017.2-2077s21c1
Sequence:CCGGTGTGAAGGGTAGTGGTATTATCTCGAGATAATACCACTACCCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks