EMAIL THIS PAGE TO A FRIEND

DMGDH

dimethylglycine dehydrogenase

56 Gene Product Result for
Synonyms: DMGDHD ME2GLYDH
UniProtKB ID: Q9UI17, B2RBN0
Gene ID:
Human(29958) Summary: This gene encodes an enzyme involved in the catabolism of choline, catalyzing the oxidative demethylation of dimethylglycine to form sarcosine. The enzyme is found as a monomer in the mitochondrial matrix, and uses flavin adenine dinucleotide and folate as cofactors. Mutation in this gene causes dimethylglycine dehydrogenase deficiency, characterized by a fishlike body odor, chronic muscle fatigue, and elevated levels of the muscle form of creatine kinase in serum. [provided by RefSeq, Jul 2008]
Mouse(74129) dimethylglycine dehydrogenase precursor
Rat(245961) dimethylglycine dehydrogenase
Zebrafish(100141496) dimethylglycine dehydrogenase
cow(504453) dimethylglycine dehydrogenase
Horse(100073267) dimethylglycine dehydrogenase
domestic cat(101089168) dimethylglycine dehydrogenase
dog(488935) dimethylglycine dehydrogenase
chicken(416370) dimethylglycine dehydrogenase
sheep(101113594) dimethylglycine dehydrogenase
Domestic Rabbit(100340207) dimethylglycine dehydrogenase
domestic guinea pig(100724353) dimethylglycine dehydrogenase
naked mole-rat(101722315) dimethylglycine dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013391 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013391 Rosetta Predictions human pricing
NM_139102 Rosetta Predictions rat pricing
NM_028772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024506 predicted 1608
2 SASI_Hs02_00344752 predicted 981
3 SASI_Hs01_00024509 predicted 1876
4 SASI_Hs02_00344753 predicted 1027
5 SASI_Hs02_00344754 predicted 1592
6 SASI_Hs01_00024510 predicted 2527
7 SASI_Hs01_00024511 predicted 2444
8 SASI_Hs02_00344755 predicted 2633
9 SASI_Hs01_00024513 predicted 2626
10 SASI_Hs01_00024514 predicted 1601
11 SASI_Hs01_00024507 predicted 1347
12 SASI_Hs01_00024508 predicted 1842
13 SASI_Hs01_00024512 predicted 1361
14 SASI_Hs01_00024515 predicted 2082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047809 predicted 2013
2 SASI_Rn02_00268476 predicted 257
3 SASI_Rn01_00047810 predicted 2487
4 SASI_Rn01_00047811 predicted 2138
5 SASI_Rn01_00047812 predicted 427
6 SASI_Rn01_00047813 predicted 1814
7 SASI_Rn01_00047814 predicted 401
8 SASI_Rn01_00047815 predicted 527
9 SASI_Rn02_00268477 predicted 1586
10 SASI_Rn01_00047816 predicted 2697
11 SASI_Rn01_00047808 predicted 1528
12 SASI_Rn01_00047817 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124617 predicted 1500
2 SASI_Mm01_00124618 predicted 1321
3 SASI_Mm01_00124619 predicted 1072
4 SASI_Mm01_00124620 predicted 2699
5 SASI_Mm01_00124621 predicted 2064
6 SASI_Mm01_00124622 predicted 1984
7 SASI_Mm01_00124623 predicted 404
8 SASI_Mm01_00124624 predicted 1341
9 SASI_Mm02_00334379 predicted 1618
10 SASI_Mm01_00124625 predicted 1934
11 SASI_Mm01_00124626 predicted 1498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028772
DMGDH MISSION shRNA Bacterial Glycerol Stock
dimethylglycine dehydrogenase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028772.3-1273s21c1
Sequence:CCGGATCCCAATCGCTACGGCAAATCTCGAGATTTGCCGTAGCGATTGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028772.3-2055s21c1
Sequence:CCGGGAAGATTCTGCGACGCTTTATCTCGAGATAAAGCGTCGCAGAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028772.3-1078s21c1
Sequence:CCGGACATCATCAATGTCGTCAATGCTCGAGCATTGACGACATTGATGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028772.1-1326s1c1
Sequence:CCGGCCGAGAATCATATGGGTTCAACTCGAGTTGAACCCATATGATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028772.1-2506s1c1
Sequence:CCGGCCAGCCACCATTATACAAGAACTCGAGTTCTTGTATAATGGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028772.1-463s1c1
Sequence:CCGGGCCACGGAACAGTATATTATTCTCGAGAATAATATACTGTTCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028772.1-2700s1c1
Sequence:CCGGCCAGATCAGTATCTTTGTAAACTCGAGTTTACAAAGATACTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028772.1-2506s1c2
Sequence:CCGGCCAGCCACCATTATACAAGAACTCGAGTTCTTGTATAATGGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028772
DMGDH MISSION shRNA shRNA Plasmid DNA
dimethylglycine dehydrogenase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028772.3-1273s21c1
Sequence:CCGGATCCCAATCGCTACGGCAAATCTCGAGATTTGCCGTAGCGATTGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028772.3-2055s21c1
Sequence:CCGGGAAGATTCTGCGACGCTTTATCTCGAGATAAAGCGTCGCAGAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028772.3-1078s21c1
Sequence:CCGGACATCATCAATGTCGTCAATGCTCGAGCATTGACGACATTGATGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028772.1-1326s1c1
Sequence:CCGGCCGAGAATCATATGGGTTCAACTCGAGTTGAACCCATATGATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028772.1-2506s1c1
Sequence:CCGGCCAGCCACCATTATACAAGAACTCGAGTTCTTGTATAATGGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028772.1-463s1c1
Sequence:CCGGGCCACGGAACAGTATATTATTCTCGAGAATAATATACTGTTCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028772.1-2700s1c1
Sequence:CCGGCCAGATCAGTATCTTTGTAAACTCGAGTTTACAAAGATACTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028772.1-2506s1c2
Sequence:CCGGCCAGCCACCATTATACAAGAACTCGAGTTCTTGTATAATGGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028772
DMGDH MISSION shRNA Lentiviral Transduction Particles
dimethylglycine dehydrogenase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028772.3-1273s21c1
Sequence:CCGGATCCCAATCGCTACGGCAAATCTCGAGATTTGCCGTAGCGATTGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028772.3-2055s21c1
Sequence:CCGGGAAGATTCTGCGACGCTTTATCTCGAGATAAAGCGTCGCAGAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028772.3-1078s21c1
Sequence:CCGGACATCATCAATGTCGTCAATGCTCGAGCATTGACGACATTGATGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028772.1-1326s1c1
Sequence:CCGGCCGAGAATCATATGGGTTCAACTCGAGTTGAACCCATATGATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028772.1-2506s1c1
Sequence:CCGGCCAGCCACCATTATACAAGAACTCGAGTTCTTGTATAATGGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028772.1-463s1c1
Sequence:CCGGGCCACGGAACAGTATATTATTCTCGAGAATAATATACTGTTCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028772.1-2700s1c1
Sequence:CCGGCCAGATCAGTATCTTTGTAAACTCGAGTTTACAAAGATACTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028772.1-2506s1c2
Sequence:CCGGCCAGCCACCATTATACAAGAACTCGAGTTCTTGTATAATGGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013391
DMGDH MISSION shRNA Bacterial Glycerol Stock
dimethylglycine dehydrogenase
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-1744s1c1
Sequence:CCGGGAGCTGACTGTTTCTCACCAACTCGAGTTGGTGAGAAACAGTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-2194s1c1
Sequence:CCGGGAGATGAACTGTGATACAAATCTCGAGATTTGTATCACAGTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-296s1c1
Sequence:CCGGCTTACTTTCATCCTGGAATAACTCGAGTTATTCCAGGATGAAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-2277s1c1
Sequence:CCGGGCAAGCACTGAAACAGATTAACTCGAGTTAATCTGTTTCAGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013391.2-2744s1c1
Sequence:CCGGGAAACCTTTCTGTTAAGTGTTCTCGAGAACACTTAACAGAAAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013391.2-2626s1c1
Sequence:CCGGCAACTGAATTAGAGTTGCTAACTCGAGTTAGCAACTCTAATTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013391.2-2621s1c1
Sequence:CCGGGCAGTCAACTGAATTAGAGTTCTCGAGAACTCTAATTCAGTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-655s1c1
Sequence:CCGGGCACCAGTAACTTCTCTGAAACTCGAGTTTCAGAGAAGTTACTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-1837s1c1
Sequence:CCGGGCAGTCAAAGGTGGATATGATCTCGAGATCATATCCACCTTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-685s1c1
Sequence:CCGGGATGGAACATGGGACGTTGAACTCGAGTTCAACGTCCCATGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-1288s1c1
Sequence:CCGGGATCCTAATCGCTATGGCAAACTCGAGTTTGCCATAGCGATTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-401s1c1
Sequence:CCGGCAGGTAGTATCAGACTTGCTACTCGAGTAGCAAGTCTGATACTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-805s1c1
Sequence:CCGGCCGGTTCAACATCAATATGTTCTCGAGAACATATTGATGTTGAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-1562s1c1
Sequence:CCGGGCTCGGAGTATAAACAGGTTACTCGAGTAACCTGTTTATACTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013391.2-2849s1c1
Sequence:CCGGCCCACATTACCCAATCAGTAACTCGAGTTACTGATTGGGTAATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-2256s1c1
Sequence:CCGGGCCAGCAGACTTCATAGGAAACTCGAGTTTCCTATGAAGTCTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-307s1c1
Sequence:CCGGCCTGGAATAAACTTGAAGAAACTCGAGTTTCTTCAAGTTTATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013391
DMGDH MISSION shRNA shRNA Plasmid DNA
dimethylglycine dehydrogenase
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-1744s1c1
Sequence:CCGGGAGCTGACTGTTTCTCACCAACTCGAGTTGGTGAGAAACAGTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-2194s1c1
Sequence:CCGGGAGATGAACTGTGATACAAATCTCGAGATTTGTATCACAGTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-296s1c1
Sequence:CCGGCTTACTTTCATCCTGGAATAACTCGAGTTATTCCAGGATGAAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-2277s1c1
Sequence:CCGGGCAAGCACTGAAACAGATTAACTCGAGTTAATCTGTTTCAGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013391.2-2744s1c1
Sequence:CCGGGAAACCTTTCTGTTAAGTGTTCTCGAGAACACTTAACAGAAAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013391.2-2626s1c1
Sequence:CCGGCAACTGAATTAGAGTTGCTAACTCGAGTTAGCAACTCTAATTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013391.2-2621s1c1
Sequence:CCGGGCAGTCAACTGAATTAGAGTTCTCGAGAACTCTAATTCAGTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-655s1c1
Sequence:CCGGGCACCAGTAACTTCTCTGAAACTCGAGTTTCAGAGAAGTTACTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-1837s1c1
Sequence:CCGGGCAGTCAAAGGTGGATATGATCTCGAGATCATATCCACCTTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-685s1c1
Sequence:CCGGGATGGAACATGGGACGTTGAACTCGAGTTCAACGTCCCATGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-1288s1c1
Sequence:CCGGGATCCTAATCGCTATGGCAAACTCGAGTTTGCCATAGCGATTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-401s1c1
Sequence:CCGGCAGGTAGTATCAGACTTGCTACTCGAGTAGCAAGTCTGATACTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-805s1c1
Sequence:CCGGCCGGTTCAACATCAATATGTTCTCGAGAACATATTGATGTTGAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-1562s1c1
Sequence:CCGGGCTCGGAGTATAAACAGGTTACTCGAGTAACCTGTTTATACTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013391.2-2849s1c1
Sequence:CCGGCCCACATTACCCAATCAGTAACTCGAGTTACTGATTGGGTAATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-2256s1c1
Sequence:CCGGGCCAGCAGACTTCATAGGAAACTCGAGTTTCCTATGAAGTCTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-307s1c1
Sequence:CCGGCCTGGAATAAACTTGAAGAAACTCGAGTTTCTTCAAGTTTATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013391
DMGDH MISSION shRNA Lentiviral Transduction Particles
dimethylglycine dehydrogenase
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-1744s1c1
Sequence:CCGGGAGCTGACTGTTTCTCACCAACTCGAGTTGGTGAGAAACAGTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-2194s1c1
Sequence:CCGGGAGATGAACTGTGATACAAATCTCGAGATTTGTATCACAGTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-296s1c1
Sequence:CCGGCTTACTTTCATCCTGGAATAACTCGAGTTATTCCAGGATGAAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-2277s1c1
Sequence:CCGGGCAAGCACTGAAACAGATTAACTCGAGTTAATCTGTTTCAGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013391.2-2744s1c1
Sequence:CCGGGAAACCTTTCTGTTAAGTGTTCTCGAGAACACTTAACAGAAAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013391.2-2626s1c1
Sequence:CCGGCAACTGAATTAGAGTTGCTAACTCGAGTTAGCAACTCTAATTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013391.2-2621s1c1
Sequence:CCGGGCAGTCAACTGAATTAGAGTTCTCGAGAACTCTAATTCAGTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-655s1c1
Sequence:CCGGGCACCAGTAACTTCTCTGAAACTCGAGTTTCAGAGAAGTTACTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-1837s1c1
Sequence:CCGGGCAGTCAAAGGTGGATATGATCTCGAGATCATATCCACCTTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-685s1c1
Sequence:CCGGGATGGAACATGGGACGTTGAACTCGAGTTCAACGTCCCATGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-1288s1c1
Sequence:CCGGGATCCTAATCGCTATGGCAAACTCGAGTTTGCCATAGCGATTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013391.2-401s1c1
Sequence:CCGGCAGGTAGTATCAGACTTGCTACTCGAGTAGCAAGTCTGATACTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-805s1c1
Sequence:CCGGCCGGTTCAACATCAATATGTTCTCGAGAACATATTGATGTTGAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-1562s1c1
Sequence:CCGGGCTCGGAGTATAAACAGGTTACTCGAGTAACCTGTTTATACTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013391.2-2849s1c1
Sequence:CCGGCCCACATTACCCAATCAGTAACTCGAGTTACTGATTGGGTAATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-2256s1c1
Sequence:CCGGGCCAGCAGACTTCATAGGAAACTCGAGTTTCCTATGAAGTCTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013391.2-307s1c1
Sequence:CCGGCCTGGAATAAACTTGAAGAAACTCGAGTTTCTTCAAGTTTATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks