EMAIL THIS PAGE TO A FRIEND

DMKN

dermokine

131 Gene Product Result for
Synonyms: UNQ729 ZD52F10
Gene ID:
Human(93099) Summary: This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Mouse(73712) dermokine
Rat(361548) dermokine
dog(476484) dermokine
cow(618159) dermokine
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172899 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172899 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172899 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033317 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035516 Rosetta Predictions human pricing
NM_001126056 Rosetta Predictions human pricing
NM_001126057 Rosetta Predictions human pricing
NM_001126058 Rosetta Predictions human pricing
NM_001126059 Rosetta Predictions human pricing
NM_001126061 Rosetta Predictions human pricing
NM_033317 Rosetta Predictions human pricing
XM_001079275 Rosetta Predictions rat pricing
XM_341835 Rosetta Predictions rat pricing
NM_028618 Rosetta Predictions mouse pricing
NM_172899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232317 predicted 362
2 SASI_Hs01_00232318 predicted 363
3 SASI_Hs01_00232319 predicted 364
4 SASI_Hs01_00232320 predicted 368
5 SASI_Hs01_00232321 predicted 356
6 SASI_Hs01_00232322 predicted 369
7 SASI_Hs01_00232323 predicted 375
8 SASI_Hs01_00232325 predicted 462
9 SASI_Hs01_00232326 predicted 164
10 SASI_Hs02_00308201 predicted 169
11 SASI_Hs01_00232324 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328047 predicted 549
2 SASI_Hs02_00328048 predicted 524
3 SASI_Hs02_00328049 predicted 524
4 SASI_Hs02_00328050 predicted 587
5 SASI_Hs02_00328051 predicted 526
6 SASI_Hs02_00328052 predicted 586
7 SASI_Hs02_00328053 predicted 590
8 SASI_Hs02_00328054 predicted 446
9 SASI_Hs02_00328055 predicted 625
10 SASI_Hs02_00328056 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328057 predicted 551
2 SASI_Hs02_00328058 predicted 524
3 SASI_Hs02_00328059 predicted 524
4 SASI_Hs02_00328060 predicted 585
5 SASI_Hs02_00328061 predicted 532
6 SASI_Hs02_00328062 predicted 591
7 SASI_Hs02_00328063 predicted 587
8 SASI_Hs02_00328064 predicted 448
9 SASI_Hs02_00328065 predicted 623
10 SASI_Hs02_00328066 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328067 predicted 552
2 SASI_Hs02_00328068 predicted 530
3 SASI_Hs02_00328069 predicted 520
4 SASI_Hs02_00328070 predicted 585
5 SASI_Hs02_00328071 predicted 530
6 SASI_Hs02_00328072 predicted 585
7 SASI_Hs02_00328073 predicted 589
8 SASI_Hs02_00328074 predicted 445
9 SASI_Hs02_00328075 predicted 624
10 SASI_Hs02_00328076 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328077 predicted 285
2 SASI_Hs02_00328078 predicted 329
3 SASI_Hs02_00328079 predicted 533
4 SASI_Hs02_00328080 predicted 540
5 SASI_Hs02_00328081 predicted 259
6 SASI_Hs02_00328082 predicted 494
7 SASI_Hs02_00328083 predicted 316
8 SASI_Hs02_00328084 predicted 329
9 SASI_Hs02_00328085 predicted 273
10 SASI_Hs02_00328086 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328097 predicted 409
2 SASI_Hs02_00328098 predicted 282
3 SASI_Hs02_00328099 predicted 281
4 SASI_Hs02_00328100 predicted 316
5 SASI_Hs02_00328101 predicted 528
6 SASI_Hs02_00328102 predicted 572
7 SASI_Hs02_00328103 predicted 494
8 SASI_Hs02_00328104 predicted 539
9 SASI_Hs02_00328105 predicted 308
10 SASI_Hs02_00328106 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177867 predicted 1695
2 SASI_Hs01_00177868 predicted 1700
3 SASI_Hs01_00177869 predicted 1698
4 SASI_Hs01_00177870 predicted 1698
5 SASI_Hs01_00177871 predicted 1694
6 SASI_Hs01_00177872 predicted 1709
7 SASI_Hs01_00177873 predicted 1707
8 SASI_Hs01_00177875 predicted 1287
9 SASI_Hs01_00177876 predicted 528
10 SASI_Hs02_00361170 predicted 1794
11 SASI_Hs01_00177874 predicted 1709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363772 predicted 1488
2 SASI_Rn02_00363773 predicted 1112
3 SASI_Rn02_00363774 predicted 1231
4 SASI_Rn02_00363775 predicted 1181
5 SASI_Rn02_00363776 predicted 1433
6 SASI_Rn02_00363777 predicted 1598
7 SASI_Rn02_00363778 predicted 1616
8 SASI_Rn02_00363779 predicted 1614
9 SASI_Rn02_00363780 predicted 1482
10 SASI_Rn02_00363781 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393433 predicted 539
2 SASI_Rn02_00393434 predicted 238
3 SASI_Rn02_00393435 predicted 581
4 SASI_Rn02_00393436 predicted 1340
5 SASI_Rn02_00393437 predicted 1316
6 SASI_Rn02_00393438 predicted 738
7 SASI_Rn02_00393439 predicted 508
8 SASI_Rn02_00393440 predicted 638
9 SASI_Rn02_00393441 predicted 219
10 SASI_Rn02_00393442 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046702 predicted 389
2 SASI_Mm01_00046703 predicted 371
3 SASI_Mm01_00046704 predicted 410
4 SASI_Mm01_00046705 predicted 372
5 SASI_Mm01_00046706 predicted 350
6 SASI_Mm01_00046707 predicted 383
7 SASI_Mm01_00046708 predicted 426
8 SASI_Mm01_00046709 predicted 373
9 SASI_Mm01_00046710 predicted 407
10 SASI_Mm01_00046711 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146051 predicted 1737
2 SASI_Mm01_00146052 predicted 1727
3 SASI_Mm01_00146053 predicted 1764
4 SASI_Mm01_00146054 predicted 1731
5 SASI_Mm01_00146055 predicted 1704
6 SASI_Mm01_00146056 predicted 1731
7 SASI_Mm01_00146057 predicted 1776
8 SASI_Mm01_00146058 predicted 1727
9 SASI_Mm01_00146059 predicted 1763
10 SASI_Mm01_00146060 predicted 1702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172899
DMKN MISSION shRNA Bacterial Glycerol Stock
dermokine
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172899.1-1795s1c1
Sequence:CCGGCAGGGAGTTTGACTGTCCTTACTCGAGTAAGGACAGTCAAACTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172899.1-1132s1c1
Sequence:CCGGGTGGAAACAAACCCGAGTGTACTCGAGTACACTCGGGTTTGTTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172899.1-1466s1c1
Sequence:CCGGCAAACGCAGCACTCCTTTCTTCTCGAGAAGAAAGGAGTGCTGCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172899.3-1306s21c1
Sequence:CCGGAGTCCAAGACGCGCTTCATTACTCGAGTAATGAAGCGCGTCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172899.3-1198s21c1
Sequence:CCGGGGTCCAATGGTGGCAATATACCTCGAGGTATATTGCCACCATTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172899.3-1031s1c1
Sequence:CCGGGGACATAGAAACATCTAATTTCTCGAGAAATTAGATGTTTCTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172899.3-1537s1c1
Sequence:CCGGCATCCAAGAACTACTACAATACTCGAGTATTGTAGTAGTTCTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172899.3-1858s21c1
Sequence:CCGGTGTGGTGTCTTGGCGACTAATCTCGAGATTAGTCGCCAAGACACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172899.3-1031s21c1
Sequence:CCGGGGACATAGAAACATCTAATTTCTCGAGAAATTAGATGTTTCTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172899.3-546s21c1
Sequence:CCGGTCTGGAGGTCATGGCGCATATCTCGAGATATGCGCCATGACCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172899
DMKN MISSION shRNA shRNA Plasmid DNA
dermokine
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172899.1-1795s1c1
Sequence:CCGGCAGGGAGTTTGACTGTCCTTACTCGAGTAAGGACAGTCAAACTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172899.1-1132s1c1
Sequence:CCGGGTGGAAACAAACCCGAGTGTACTCGAGTACACTCGGGTTTGTTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172899.1-1466s1c1
Sequence:CCGGCAAACGCAGCACTCCTTTCTTCTCGAGAAGAAAGGAGTGCTGCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172899.3-1306s21c1
Sequence:CCGGAGTCCAAGACGCGCTTCATTACTCGAGTAATGAAGCGCGTCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172899.3-1198s21c1
Sequence:CCGGGGTCCAATGGTGGCAATATACCTCGAGGTATATTGCCACCATTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172899.3-1031s1c1
Sequence:CCGGGGACATAGAAACATCTAATTTCTCGAGAAATTAGATGTTTCTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172899.3-1537s1c1
Sequence:CCGGCATCCAAGAACTACTACAATACTCGAGTATTGTAGTAGTTCTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172899.3-1858s21c1
Sequence:CCGGTGTGGTGTCTTGGCGACTAATCTCGAGATTAGTCGCCAAGACACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172899.3-1031s21c1
Sequence:CCGGGGACATAGAAACATCTAATTTCTCGAGAAATTAGATGTTTCTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172899.3-546s21c1
Sequence:CCGGTCTGGAGGTCATGGCGCATATCTCGAGATATGCGCCATGACCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172899
DMKN MISSION shRNA Lentiviral Transduction Particles
dermokine
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172899.1-1795s1c1
Sequence:CCGGCAGGGAGTTTGACTGTCCTTACTCGAGTAAGGACAGTCAAACTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172899.1-1132s1c1
Sequence:CCGGGTGGAAACAAACCCGAGTGTACTCGAGTACACTCGGGTTTGTTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172899.1-1466s1c1
Sequence:CCGGCAAACGCAGCACTCCTTTCTTCTCGAGAAGAAAGGAGTGCTGCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172899.3-1306s21c1
Sequence:CCGGAGTCCAAGACGCGCTTCATTACTCGAGTAATGAAGCGCGTCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172899.3-1198s21c1
Sequence:CCGGGGTCCAATGGTGGCAATATACCTCGAGGTATATTGCCACCATTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172899.3-1031s1c1
Sequence:CCGGGGACATAGAAACATCTAATTTCTCGAGAAATTAGATGTTTCTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172899.3-1537s1c1
Sequence:CCGGCATCCAAGAACTACTACAATACTCGAGTATTGTAGTAGTTCTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172899.3-1858s21c1
Sequence:CCGGTGTGGTGTCTTGGCGACTAATCTCGAGATTAGTCGCCAAGACACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172899.3-1031s21c1
Sequence:CCGGGGACATAGAAACATCTAATTTCTCGAGAAATTAGATGTTTCTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172899.3-546s21c1
Sequence:CCGGTCTGGAGGTCATGGCGCATATCTCGAGATATGCGCCATGACCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033317
VALIDATED
DMKN MISSION shRNA Bacterial Glycerol Stock
dermokine
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033317.2-1245s1c1
Sequence:CCGGCTTTGACACTTTCTGGAAGAACTCGAGTTCTTCCAGAAAGTGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_033317.2-1734s1c1
Sequence:CCGGCCAGCTTGTCTCTCCTTGTTTCTCGAGAAACAAGGAGAGACAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033317.2-587s1c1
Sequence:CCGGGCCACAATGGTGCTTGGGAAACTCGAGTTTCCCAAGCACCATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033317.2-1737s1c1
Sequence:CCGGGCTTGTCTCTCCTTGTTTCTTCTCGAGAAGAAACAAGGAGAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_033317.2-1458s1c1
Sequence:CCGGCGATCAGAACTACAATTACAACTCGAGTTGTAATTGTAGTTCTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033317.2-1452s1c1
Sequence:CCGGCAGAGCCGATCAGAACTACAACTCGAGTTGTAGTTCTGATCGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033317.2-718s1c1
Sequence:CCGGGCAGGCAGCTTTGGAATGAATCTCGAGATTCATTCCAAAGCTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033317.2-529s1c1
Sequence:CCGGGAAGATGTCATTCGACACGGACTCGAGTCCGTGTCGAATGACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_033317.2-1794s1c1
Sequence:CCGGCGTCACATACACCAGCATCTTCTCGAGAAGATGCTGGTGTATGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033317.2-1357s1c1
Sequence:CCGGCGACTCTGGGAGGATTTCAAACTCGAGTTTGAAATCCTCCCAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033317.3-503s21c1
Sequence:CCGGGAAACACTGGGCACGAGATTGCTCGAGCAATCTCGTGCCCAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033317.3-842s21c1
Sequence:CCGGTGAGAGCCAGCAACCAGAATGCTCGAGCATTCTGGTTGCTGGCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033317
VALIDATED
DMKN MISSION shRNA shRNA Plasmid DNA
dermokine
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033317.2-1245s1c1
Sequence:CCGGCTTTGACACTTTCTGGAAGAACTCGAGTTCTTCCAGAAAGTGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_033317.2-1734s1c1
Sequence:CCGGCCAGCTTGTCTCTCCTTGTTTCTCGAGAAACAAGGAGAGACAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033317.2-587s1c1
Sequence:CCGGGCCACAATGGTGCTTGGGAAACTCGAGTTTCCCAAGCACCATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033317.2-1737s1c1
Sequence:CCGGGCTTGTCTCTCCTTGTTTCTTCTCGAGAAGAAACAAGGAGAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_033317.2-1458s1c1
Sequence:CCGGCGATCAGAACTACAATTACAACTCGAGTTGTAATTGTAGTTCTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033317.2-1452s1c1
Sequence:CCGGCAGAGCCGATCAGAACTACAACTCGAGTTGTAGTTCTGATCGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033317.2-718s1c1
Sequence:CCGGGCAGGCAGCTTTGGAATGAATCTCGAGATTCATTCCAAAGCTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033317.2-529s1c1
Sequence:CCGGGAAGATGTCATTCGACACGGACTCGAGTCCGTGTCGAATGACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_033317.2-1794s1c1
Sequence:CCGGCGTCACATACACCAGCATCTTCTCGAGAAGATGCTGGTGTATGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033317.2-1357s1c1
Sequence:CCGGCGACTCTGGGAGGATTTCAAACTCGAGTTTGAAATCCTCCCAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033317.3-503s21c1
Sequence:CCGGGAAACACTGGGCACGAGATTGCTCGAGCAATCTCGTGCCCAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033317.3-842s21c1
Sequence:CCGGTGAGAGCCAGCAACCAGAATGCTCGAGCATTCTGGTTGCTGGCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033317
VALIDATED
DMKN MISSION shRNA Lentiviral Transduction Particles
dermokine
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033317.2-1245s1c1
Sequence:CCGGCTTTGACACTTTCTGGAAGAACTCGAGTTCTTCCAGAAAGTGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_033317.2-1734s1c1
Sequence:CCGGCCAGCTTGTCTCTCCTTGTTTCTCGAGAAACAAGGAGAGACAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033317.2-587s1c1
Sequence:CCGGGCCACAATGGTGCTTGGGAAACTCGAGTTTCCCAAGCACCATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033317.2-1737s1c1
Sequence:CCGGGCTTGTCTCTCCTTGTTTCTTCTCGAGAAGAAACAAGGAGAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_033317.2-1458s1c1
Sequence:CCGGCGATCAGAACTACAATTACAACTCGAGTTGTAATTGTAGTTCTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033317.2-1452s1c1
Sequence:CCGGCAGAGCCGATCAGAACTACAACTCGAGTTGTAGTTCTGATCGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033317.2-718s1c1
Sequence:CCGGGCAGGCAGCTTTGGAATGAATCTCGAGATTCATTCCAAAGCTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033317.2-529s1c1
Sequence:CCGGGAAGATGTCATTCGACACGGACTCGAGTCCGTGTCGAATGACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_033317.2-1794s1c1
Sequence:CCGGCGTCACATACACCAGCATCTTCTCGAGAAGATGCTGGTGTATGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033317.2-1357s1c1
Sequence:CCGGCGACTCTGGGAGGATTTCAAACTCGAGTTTGAAATCCTCCCAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033317.3-503s21c1
Sequence:CCGGGAAACACTGGGCACGAGATTGCTCGAGCAATCTCGTGCCCAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033317.3-842s21c1
Sequence:CCGGTGAGAGCCAGCAACCAGAATGCTCGAGCATTCTGGTTGCTGGCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks