EMAIL THIS PAGE TO A FRIEND

DMP1

dentin matrix acidic phosphoprotein 1

68 Gene Product Result for
Synonyms: ARHP ARHR DMP-1
UniProtKB ID: Q13316, A1L4L3, O43265
Gene ID:
Human(1758) Summary: Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(13406) dentin matrix protein 1
Rat(25312) dentin matrix acidic phosphoprotein 1
Thale Cress(821706) DUF679 domain membrane protein 1
chicken(404539) dentin matrix acidic phosphoprotein 1
dog(487849) dentin matrix acidic phosphoprotein 1
domestic cat(101095652) dentin matrix acidic phosphoprotein 1
cow(281118) dentin matrix acidic phosphoprotein 1
sheep(101123558) dentin matrix acidic phosphoprotein 1
sheep(100861441) dentin matrix acidic phosphoprotein 1
domestic guinea pig(100732102) dentin matrix acidic phosphoprotein 1
naked mole-rat(101725040) dentin matrix acidic phosphoprotein 1
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004407 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151921 MISSION® esiRNA esiRNA human DMP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079911 Rosetta Predictions human pricing
NM_004407 Rosetta Predictions human pricing
NM_203493 Rosetta Predictions rat pricing
NM_016779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314130 predicted 792
2 SASI_Hs02_00314131 predicted 1459
3 SASI_Hs02_00314132 predicted 1045
4 SASI_Hs02_00314133 predicted 1602
5 SASI_Hs02_00314134 predicted 1151
6 SASI_Hs02_00314135 predicted 1503
7 SASI_Hs02_00314136 predicted 524
8 SASI_Hs02_00314137 predicted 741
9 SASI_Hs02_00314138 predicted 917
10 SASI_Hs02_00314139 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337541 predicted 835
2 SASI_Hs02_00337542 predicted 1508
3 SASI_Hs02_00337543 predicted 1094
4 SASI_Hs01_00122091 predicted 1650
5 SASI_Hs01_00122092 predicted 1205
6 SASI_Hs01_00122093 predicted 1549
7 SASI_Hs01_00122095 predicted 567
8 SASI_Hs01_00122097 predicted 782
9 SASI_Hs02_00337544 predicted 962
10 SASI_Hs02_00337545 predicted 1573
11 SASI_Hs01_00122090 predicted 253
12 SASI_Hs01_00122094 predicted 246
13 SASI_Hs01_00122096 predicted 507
14 SASI_Hs01_00122098 predicted 1210
15 SASI_Hs01_00122099 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086455 predicted 1902
2 SASI_Rn01_00086456 predicted 1122
3 SASI_Rn01_00086457 predicted 650
4 SASI_Rn01_00086458 predicted 505
5 SASI_Rn01_00086459 predicted 1920
6 SASI_Rn02_00270370 predicted 1976
7 SASI_Rn01_00086460 predicted 270
8 SASI_Rn01_00086463 predicted 1904
9 SASI_Rn02_00270371 predicted 1068
10 SASI_Rn01_00086464 predicted 351
11 SASI_Rn01_00086461 predicted 524
12 SASI_Rn01_00086462 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152404 predicted 247
2 SASI_Mm01_00152405 predicted 800
3 SASI_Mm01_00152406 predicted 504
4 SASI_Mm01_00152407 predicted 1114
5 SASI_Mm01_00152408 predicted 213
6 SASI_Mm01_00152409 predicted 914
7 SASI_Mm02_00323553 predicted 1511
8 SASI_Mm01_00152410 predicted 1235
9 SASI_Mm01_00152411 predicted 415
10 SASI_Mm01_00152412 predicted 2039
11 SASI_Mm01_00152413 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004407
DMP1 MISSION shRNA Bacterial Glycerol Stock
dentin matrix acidic phosphoprotein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004407.3-1939s21c1
Sequence:CCGGGCTATTGGGTGTCCATGATATCTCGAGATATCATGGACACCCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004407.3-332s21c1
Sequence:CCGGGGGCTCTGATGATCATCAATACTCGAGTATTGATGATCATCAGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004407.3-2120s21c1
Sequence:CCGGGAGAGCTATGAACACGATATCCTCGAGGATATCGTGTTCATAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-1582s1c1
Sequence:CCGGGCCTATCACAACAAACCCATTCTCGAGAATGGGTTTGTTGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-235s1c1
Sequence:CCGGGAGAGCAGTGAGTCATCAGAACTCGAGTTCTGATGACTCACTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-789s1c1
Sequence:CCGGCAGAATGAACAGTGCAGGCATCTCGAGATGCCTGCACTGTTCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-1561s1c1
Sequence:CCGGAGCCGGAAATTAACAGTTGATCTCGAGATCAACTGTTAATTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-942s1c1
Sequence:CCGGGCTTGATGACAACAACACAATCTCGAGATTGTGTTGTTGTCATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004407
DMP1 MISSION shRNA shRNA Plasmid DNA
dentin matrix acidic phosphoprotein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004407.3-1939s21c1
Sequence:CCGGGCTATTGGGTGTCCATGATATCTCGAGATATCATGGACACCCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004407.3-332s21c1
Sequence:CCGGGGGCTCTGATGATCATCAATACTCGAGTATTGATGATCATCAGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004407.3-2120s21c1
Sequence:CCGGGAGAGCTATGAACACGATATCCTCGAGGATATCGTGTTCATAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-1582s1c1
Sequence:CCGGGCCTATCACAACAAACCCATTCTCGAGAATGGGTTTGTTGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-235s1c1
Sequence:CCGGGAGAGCAGTGAGTCATCAGAACTCGAGTTCTGATGACTCACTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-789s1c1
Sequence:CCGGCAGAATGAACAGTGCAGGCATCTCGAGATGCCTGCACTGTTCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-1561s1c1
Sequence:CCGGAGCCGGAAATTAACAGTTGATCTCGAGATCAACTGTTAATTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-942s1c1
Sequence:CCGGGCTTGATGACAACAACACAATCTCGAGATTGTGTTGTTGTCATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004407
DMP1 MISSION shRNA Lentiviral Transduction Particles
dentin matrix acidic phosphoprotein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004407.3-1939s21c1
Sequence:CCGGGCTATTGGGTGTCCATGATATCTCGAGATATCATGGACACCCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004407.3-332s21c1
Sequence:CCGGGGGCTCTGATGATCATCAATACTCGAGTATTGATGATCATCAGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004407.3-2120s21c1
Sequence:CCGGGAGAGCTATGAACACGATATCCTCGAGGATATCGTGTTCATAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-1582s1c1
Sequence:CCGGGCCTATCACAACAAACCCATTCTCGAGAATGGGTTTGTTGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-235s1c1
Sequence:CCGGGAGAGCAGTGAGTCATCAGAACTCGAGTTCTGATGACTCACTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-789s1c1
Sequence:CCGGCAGAATGAACAGTGCAGGCATCTCGAGATGCCTGCACTGTTCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-1561s1c1
Sequence:CCGGAGCCGGAAATTAACAGTTGATCTCGAGATCAACTGTTAATTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004407.1-942s1c1
Sequence:CCGGGCTTGATGACAACAACACAATCTCGAGATTGTGTTGTTGTCATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016779
DMP1 MISSION shRNA Bacterial Glycerol Stock
dentin matrix acidic phosphoprotein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016779.1-2565s1c1
Sequence:CCGGCCTTTCTATGTGTTGCACATACTCGAGTATGTGCAACACATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016779.1-1532s1c1
Sequence:CCGGGCTGACAGTAGGAAACTAATACTCGAGTATTAGTTTCCTACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016779.1-707s1c1
Sequence:CCGGGACGGTTCTGAGTTCGATGATCTCGAGATCATCGAACTCAGAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016779.1-1535s1c1
Sequence:CCGGGACAGTAGGAAACTAATAGTTCTCGAGAACTATTAGTTTCCTACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016779.1-164s1c1
Sequence:CCGGGCCAGATACCACAATACTGAACTCGAGTTCAGTATTGTGGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016779
DMP1 MISSION shRNA shRNA Plasmid DNA
dentin matrix acidic phosphoprotein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016779.1-2565s1c1
Sequence:CCGGCCTTTCTATGTGTTGCACATACTCGAGTATGTGCAACACATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016779.1-1532s1c1
Sequence:CCGGGCTGACAGTAGGAAACTAATACTCGAGTATTAGTTTCCTACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016779.1-707s1c1
Sequence:CCGGGACGGTTCTGAGTTCGATGATCTCGAGATCATCGAACTCAGAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016779.1-1535s1c1
Sequence:CCGGGACAGTAGGAAACTAATAGTTCTCGAGAACTATTAGTTTCCTACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016779.1-164s1c1
Sequence:CCGGGCCAGATACCACAATACTGAACTCGAGTTCAGTATTGTGGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016779
DMP1 MISSION shRNA Lentiviral Transduction Particles
dentin matrix acidic phosphoprotein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016779.1-2565s1c1
Sequence:CCGGCCTTTCTATGTGTTGCACATACTCGAGTATGTGCAACACATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016779.1-1532s1c1
Sequence:CCGGGCTGACAGTAGGAAACTAATACTCGAGTATTAGTTTCCTACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016779.1-707s1c1
Sequence:CCGGGACGGTTCTGAGTTCGATGATCTCGAGATCATCGAACTCAGAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016779.1-1535s1c1
Sequence:CCGGGACAGTAGGAAACTAATAGTTCTCGAGAACTATTAGTTTCCTACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016779.1-164s1c1
Sequence:CCGGGCCAGATACCACAATACTGAACTCGAGTTCAGTATTGTGGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks