EMAIL THIS PAGE TO A FRIEND

DMPK

dystrophia myotonica-protein kinase

118 Gene Product Result for
Synonyms: DM DM1 DM1PK DMK MDPK MT-PK
UniProtKB ID: Q09013, Q16205, Q6P5Z6
Gene ID:
Human(1760) Summary: The protein encoded by this gene is a serine-threonine kinase that is closely related to other kinases that interact with members of the Rho family of small GTPases. Substrates for this enzyme include myogenin, the beta-subunit of the L-type calcium channels, and phospholemman. The 3' untranslated region of this gene contains 5-37 copies of a CTG trinucleotide repeat. Expansion of this unstable motif to 50-5,000 copies causes myotonic dystrophy type I, which increases in severity with increasing repeat element copy number. Repeat expansion is associated with condensation of local chromatin structure that disrupts the expression of genes in this region. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(13400) dystrophia myotonica-protein kinase
Rat(308405) dystrophia myotonica-protein kinase
cow(513675) dystrophia myotonica-protein kinase
domestic cat(101081940) dystrophia myotonica-protein kinase
dog(484436) dystrophia myotonica-protein kinase
sheep(101118379) dystrophia myotonica-protein kinase
naked mole-rat(101702744) dystrophia myotonica-protein kinase
domestic guinea pig(100713533) dystrophia myotonica-protein kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004409 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_032418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081560 Rosetta Predictions human pricing
NM_001081562 Rosetta Predictions human pricing
NM_001081563 Rosetta Predictions human pricing
NM_004409 Rosetta Predictions human pricing
NM_001107484 Rosetta Predictions rat pricing
NM_032418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316433 predicted 998
2 SASI_Hs02_00316434 predicted 832
3 SASI_Hs02_00316435 predicted 1065
4 SASI_Hs02_00316436 predicted 2066
5 SASI_Hs02_00316437 predicted 1060
6 SASI_Hs02_00316438 predicted 955
7 SASI_Hs02_00316439 predicted 835
8 SASI_Hs02_00316440 predicted 1044
9 SASI_Hs02_00316441 predicted 705
10 SASI_Hs02_00316442 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316443 predicted 997
2 SASI_Hs02_00316444 predicted 839
3 SASI_Hs02_00316445 predicted 1065
4 SASI_Hs02_00316446 predicted 2067
5 SASI_Hs02_00316447 predicted 1067
6 SASI_Hs02_00316448 predicted 958
7 SASI_Hs02_00316449 predicted 838
8 SASI_Hs02_00316450 predicted 1039
9 SASI_Hs02_00316451 predicted 710
10 SASI_Hs02_00316452 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316453 predicted 1366
2 SASI_Hs02_00316454 predicted 1202
3 SASI_Hs02_00316455 predicted 1433
4 SASI_Hs02_00316456 predicted 2450
5 SASI_Hs02_00316457 predicted 1430
6 SASI_Hs02_00316458 predicted 1329
7 SASI_Hs02_00316459 predicted 1208
8 SASI_Hs02_00316460 predicted 1410
9 SASI_Hs02_00316461 predicted 1077
10 SASI_Hs02_00316462 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337547 predicted 994
2 SASI_Hs02_00337548 predicted 835
3 SASI_Hs01_00235679 predicted 1065
4 SASI_Hs01_00235680 predicted 2080
5 SASI_Hs02_00337549 predicted 1059
6 SASI_Hs01_00235681 predicted 961
7 SASI_Hs02_00337550 predicted 832
8 SASI_Hs02_00337551 predicted 1039
9 SASI_Hs02_00337552 predicted 709
10 SASI_Hs02_00337553 predicted 1059
11 SASI_Hs01_00235676 predicted 2375
12 SASI_Hs01_00235677 predicted 2458
13 SASI_Hs01_00235678 predicted 1752
14 SASI_Hs01_00235682 predicted 1182
15 SASI_Hs01_00235683 predicted 1127
16 SASI_Hs01_00235684 predicted 1281
17 SASI_Hs01_00235685 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107484 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229285 predicted 377
2 SASI_Rn02_00229286 predicted 368
3 SASI_Rn02_00229287 predicted 297
4 SASI_Rn02_00229288 predicted 301
5 SASI_Rn02_00229289 predicted 377
6 SASI_Rn02_00229290 predicted 320
7 SASI_Rn02_00229291 predicted 328
8 SASI_Rn02_00229292 predicted 521
9 SASI_Rn02_00229293 predicted 452
10 SASI_Rn02_00229294 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149278 predicted 832
2 SASI_Mm02_00337245 predicted 846
3 SASI_Mm01_00149279 predicted 1634
4 SASI_Mm02_00337246 predicted 353
5 SASI_Mm01_00149281 predicted 644
6 SASI_Mm01_00149282 predicted 1210
7 SASI_Mm01_00149283 predicted 1335
8 SASI_Mm02_00337247 predicted 1391
9 SASI_Mm01_00149284 predicted 1187
10 SASI_Mm01_00149285 predicted 284
11 SASI_Mm01_00149277 predicted 354
12 SASI_Mm01_00149280 predicted 1499
13 SASI_Mm01_00149286 predicted 1229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004409
VALIDATED
DMPK MISSION shRNA Bacterial Glycerol Stock
dystrophia myotonica-protein kinase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004409.2-916s1c1
Sequence:CCGGCTGGGTGTATTCGCCTATGAACTCGAGTTCATAGGCGAATACACCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004409.2-292s1c1
Sequence:CCGGCCCATCGTGGTGAGGCTTAAGCTCGAGCTTAAGCCTCACCACGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004409.2-1208s1c1
Sequence:CCGGCCACCGACACATGCAACTTCGCTCGAGCGAAGTTGCATGTGTCGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004409.2-595s1c1
Sequence:CCGGCTGACACTGCTGAGCAAGTTTCTCGAGAAACTTGCTCAGCAGTGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004409.x-1706s1c1
Sequence:CCGGTCGAGACTTCATTCAGCGGTTCTCGAGAACCGCTGAATGAAGTCTCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004409.x-1211s1c1
Sequence:CCGGCCTGGTCATGGAGTATTACGTCTCGAGACGTAATACTCCATGACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004409.x-1031s1c1
Sequence:CCGGAGCGGTAGTGAAGATGAAGCACTCGAGTGCTTCATCTTCACTACCGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004409.x-1833s1c1
Sequence:CCGGCCCTTTACACCGGATTTCGAACTCGAGTTCGAAATCCGGTGTAAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004409.3-2499s21c1
Sequence:CCGGACCTATCGTTGGTTCGCAAAGCTCGAGCTTTGCGAACCAACGATAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004409
VALIDATED
DMPK MISSION shRNA shRNA Plasmid DNA
dystrophia myotonica-protein kinase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004409.2-916s1c1
Sequence:CCGGCTGGGTGTATTCGCCTATGAACTCGAGTTCATAGGCGAATACACCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004409.2-292s1c1
Sequence:CCGGCCCATCGTGGTGAGGCTTAAGCTCGAGCTTAAGCCTCACCACGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004409.2-1208s1c1
Sequence:CCGGCCACCGACACATGCAACTTCGCTCGAGCGAAGTTGCATGTGTCGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004409.2-595s1c1
Sequence:CCGGCTGACACTGCTGAGCAAGTTTCTCGAGAAACTTGCTCAGCAGTGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004409.x-1706s1c1
Sequence:CCGGTCGAGACTTCATTCAGCGGTTCTCGAGAACCGCTGAATGAAGTCTCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004409.x-1211s1c1
Sequence:CCGGCCTGGTCATGGAGTATTACGTCTCGAGACGTAATACTCCATGACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004409.x-1031s1c1
Sequence:CCGGAGCGGTAGTGAAGATGAAGCACTCGAGTGCTTCATCTTCACTACCGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004409.x-1833s1c1
Sequence:CCGGCCCTTTACACCGGATTTCGAACTCGAGTTCGAAATCCGGTGTAAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004409.3-2499s21c1
Sequence:CCGGACCTATCGTTGGTTCGCAAAGCTCGAGCTTTGCGAACCAACGATAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004409
VALIDATED
DMPK MISSION shRNA Lentiviral Transduction Particles
dystrophia myotonica-protein kinase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004409.2-916s1c1
Sequence:CCGGCTGGGTGTATTCGCCTATGAACTCGAGTTCATAGGCGAATACACCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004409.2-292s1c1
Sequence:CCGGCCCATCGTGGTGAGGCTTAAGCTCGAGCTTAAGCCTCACCACGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004409.2-1208s1c1
Sequence:CCGGCCACCGACACATGCAACTTCGCTCGAGCGAAGTTGCATGTGTCGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004409.2-595s1c1
Sequence:CCGGCTGACACTGCTGAGCAAGTTTCTCGAGAAACTTGCTCAGCAGTGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004409.x-1706s1c1
Sequence:CCGGTCGAGACTTCATTCAGCGGTTCTCGAGAACCGCTGAATGAAGTCTCGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004409.x-1211s1c1
Sequence:CCGGCCTGGTCATGGAGTATTACGTCTCGAGACGTAATACTCCATGACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004409.x-1031s1c1
Sequence:CCGGAGCGGTAGTGAAGATGAAGCACTCGAGTGCTTCATCTTCACTACCGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004409.x-1833s1c1
Sequence:CCGGCCCTTTACACCGGATTTCGAACTCGAGTTCGAAATCCGGTGTAAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004409.3-2499s21c1
Sequence:CCGGACCTATCGTTGGTTCGCAAAGCTCGAGCTTTGCGAACCAACGATAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032418
DMPK MISSION shRNA Bacterial Glycerol Stock
dystrophia myotonica-protein kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-988s1c1
Sequence:CCGGGCAGGTGATTTCCAGAAACATCTCGAGATGTTTCTGGAAATCACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-1330s1c1
Sequence:CCGGCCACCGGATCAAGTGGCTGAACTCGAGTTCAGCCACTTGATCCGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-1495s1c1
Sequence:CCGGCAGAACTTCTCCAGCCAACTACTCGAGTAGTTGGCTGGAGAAGTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-300s1c1
Sequence:CCGGGATTATGAATAAGTGGGACATCTCGAGATGTCCCACTTATTCATAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-850s1c1
Sequence:CCGGGCCGAGACATATGCCAAGATTCTCGAGAATCTTGGCATATGTCTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032418.1-584s21c1
Sequence:CCGGACATCAAACCAGATAACATTCCTCGAGGAATGTTATCTGGTTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032418.1-841s21c1
Sequence:CCGGGACTCCACAGCCGAGACATATCTCGAGATATGTCTCGGCTGTGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032418.1-1081s21c1
Sequence:CCGGGCCACGGACACATGCAATTTCCTCGAGGAAATTGCATGTGTCCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032418
DMPK MISSION shRNA shRNA Plasmid DNA
dystrophia myotonica-protein kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-988s1c1
Sequence:CCGGGCAGGTGATTTCCAGAAACATCTCGAGATGTTTCTGGAAATCACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-1330s1c1
Sequence:CCGGCCACCGGATCAAGTGGCTGAACTCGAGTTCAGCCACTTGATCCGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-1495s1c1
Sequence:CCGGCAGAACTTCTCCAGCCAACTACTCGAGTAGTTGGCTGGAGAAGTTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-300s1c1
Sequence:CCGGGATTATGAATAAGTGGGACATCTCGAGATGTCCCACTTATTCATAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-850s1c1
Sequence:CCGGGCCGAGACATATGCCAAGATTCTCGAGAATCTTGGCATATGTCTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032418.1-584s21c1
Sequence:CCGGACATCAAACCAGATAACATTCCTCGAGGAATGTTATCTGGTTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032418.1-841s21c1
Sequence:CCGGGACTCCACAGCCGAGACATATCTCGAGATATGTCTCGGCTGTGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032418.1-1081s21c1
Sequence:CCGGGCCACGGACACATGCAATTTCCTCGAGGAAATTGCATGTGTCCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032418
DMPK MISSION shRNA Lentiviral Transduction Particles
dystrophia myotonica-protein kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-988s1c1
Sequence:CCGGGCAGGTGATTTCCAGAAACATCTCGAGATGTTTCTGGAAATCACCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-1330s1c1
Sequence:CCGGCCACCGGATCAAGTGGCTGAACTCGAGTTCAGCCACTTGATCCGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-1495s1c1
Sequence:CCGGCAGAACTTCTCCAGCCAACTACTCGAGTAGTTGGCTGGAGAAGTTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-300s1c1
Sequence:CCGGGATTATGAATAAGTGGGACATCTCGAGATGTCCCACTTATTCATAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032418.1-850s1c1
Sequence:CCGGGCCGAGACATATGCCAAGATTCTCGAGAATCTTGGCATATGTCTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032418.1-584s21c1
Sequence:CCGGACATCAAACCAGATAACATTCCTCGAGGAATGTTATCTGGTTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032418.1-841s21c1
Sequence:CCGGGACTCCACAGCCGAGACATATCTCGAGATATGTCTCGGCTGTGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032418.1-1081s21c1
Sequence:CCGGGCCACGGACACATGCAATTTCCTCGAGGAAATTGCATGTGTCCGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)